Labshake search
Citations for Bioline :
201 - 250 of 377 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... qPCRs were carried out in 15 μl in a 384-well plate using SensiFASTTM SYBR Hi-ROX kit (Bioline), 0·5 μM of each forward and reverse primer and 2·5 μl of template DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time RT-PCR was performed using a SensiFastTM SYBR® Hi-ROX kit (#BIO-92020; Bioline USA Inc.) in an Applied Biosystems QuantStudio 7 Flex Real-Time PCR system (Thermo Fisher Scientific Inc.) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25uM forward and reverse oligo primers (see supplementary table 6) and SensiFAST SYBR Hi-ROX Kit (Bioline, BIO-92005) in 384-well plates with the LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Physiology 2021Quote: ... using the SensiFAST™cDNA Synthesis Kit (Bioline). Quantitative PCR was performed with the SensiFAST™SYBR® No-Rox Kit (Bioline ...
-
bioRxiv - Microbiology 2021Quote: ... using First strand cDNA synthesis kit (Bioline, UK), 1 μg of total RNA was converted into cDNA ...
-
bioRxiv - Genetics 2020Quote: ... cDNA was synthesized with SensiFast (Bioline, BIO-65053). TaqMan® Fast Advanced Master Mix and the following TaqMan Gene Expression Assays (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using Bioscript reverse transcriptase (Bioline), Random Primers (Thermo Fisher) ...
-
bioRxiv - Genomics 2021Quote: ... cDNA was synthesized using Bioscript reverse transcriptase (Bioline), Random Primers (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... using SensiFAST cDNA Synthesis Kit (Bioline, London, UK). Template RNA and resulting cDNA quality and concentration were assessed using ND-1000 Nanodrop system (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2022Quote: ... First-strand cDNA was generated using BioScript (Bioline) and random hexamer primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... the Tetro cDNA Synthesis Kit (BIO-65043; BioLine) was used for transcribing mRNA into cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Tetro cDNA synthesis kit (BIOLINE, Cat# BIO-65043) was employed to synthesis cDNA ...
-
bioRxiv - Genetics 2024Quote: ... cDNA synthesised using oligoDT and random hexamers (Bioline). Quantitative PCR was performed on a lightcycler (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... total RNA of both uninfected and DENV1-infected samples were subjected cDNA synthesis using Tetro cDNA synthesis kit (Bioline, BIO-65042). Reverse oligo of DENV1 specific primer was used in cDNA synthesis ...
-
bioRxiv - Plant Biology 2024Quote: ... The total RNA was then converted to cDNA by reverse transcription with the SensiFAST™ cDNA Synthesis Kit (Bioline, https://www.bioline.com). For each quantitative real-time RT-PCR reaction ...
-
bioRxiv - Developmental Biology 2021Quote: ... Every clone was genotyped by PCR (MangoTaq, Bioline, Cat.N. 25033) (primers listed in Supp ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We labeled each library with a sample-specific pair of barcodes and combined libraries in equimolar ratios based on qPCR using SensiFAST SYBR Hi-ROX master mix (Bioline), then sequenced the combined pools on four lanes of 50bp single end reads (Illumina HiSeq2500 ...
-
bioRxiv - Neuroscience 2020Quote: ... The cDNA products were diluted 10 times and used for qPCR using a StepOnePlusTM instrument (Applied Biosystem, USA) and SensiFAST SYBR Hi-ROX Kit (Bioline) following the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2021Quote: qRT-PCR was used to quantify transcript levels of specific quorum sensing-controlled genes in DS40M4 and was performed using the SensiFast SYBR Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2021Quote: Real-time qRT-PCR (quantitative reverse transcription PCR) was used to quantify transcript levels using the SensiFast SYBR Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA was then diluted and used as template for qPCR, which was performed with a StepOnePlus instrument (Applied Biosystem, USA) and SensiFAST SYBR Hi-ROX Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: qPCR was performed on each of the samples using an Applied Biosystems StepOnePlus system with a Sensifast Hi-Rox Sybr kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Microbiology 2024Quote: ... was used to quantify transcript levels of T3SS genes in different regulatory conditions and was performed using the SensiFast SYBR Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s guidelines ...
-
bioRxiv - Developmental Biology 2024Quote: ... and qPCR was performed using gene-specific primer sets (listed in Supplemental Table 1) and SensiFast SYBR Hi-ROX master mix (Bioline). MiRNA qRT-PCR was performed with the polyA and SYBR Green method as previously described using miRNA-specific forward primers and a 3’ RACE adaptor reverse primer62 ...
-
bioRxiv - Microbiology 2020Quote: ... 250-1,000 ng of extracted RNA was converted to cDNA in a reaction volume of 20 μl using the Tetro cDNA synthesis kit (BIO-65043, Bioline, London, UK). The cDNA was then amplified using an SYBR green RT-PCR kit (06924204001 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and mClover3-bElys constructs were cloned from bovine fibroblast or bovine oocyte cDNA libraries made using a SensiFAST cDNA synthesis kit (Bioline, BIO-65053). The primers (KASH5-DN cloning ...
-
bioRxiv - Molecular Biology 2020Quote: Complementary DNA (cDNA) used for in situ hybridisation and quantitative PCR (qPCR) was synthesised using the Tetro cDNA synthesis kit (Bioline, London, UK) with oligo-dT primers according to the manufacturers’ instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... and one μg of total RNA from each sample was converted into cDNA with SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK) using a T100™ Thermal Cycler (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... 750 ng total RNA was reverse transcribed to form cDNA according to the manufacturer’s protocol (SensiFAST™ cDNA Synthesis Kit, Bioline, Luckenwalde, Germany). Real-time PCR analyses were performed on a MyiQ Single-Color Real-Time PCR detection system (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... 750 ng total RNA was reverse transcribed to form cDNA according to the manufacturer’s protocol (SensiFAST™ cDNA Synthesis Kit, Bioline, Luckenwalde, Germany). Real-time PCR analysis was performed according to the manufacturer’s protocol (SensiMix™ SYBR® & Fluorescein Kit ...
-
bioRxiv - Synthetic Biology 2022Quote: Up to 900 ng of RNA was used per sample to synthesise cDNA using the SensiFAST cDNA Synthesis kit (Bioline, #BIO-65054) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Purified nucleic acid was then immediately converted to cDNA by reverse transcription with random hexamers using the SensiFAST cDNA Synthesis Kit (Bioline Reagents, UK) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng of the total RNA was reverse-transcribed into cDNA using a Tetro cDNA synthesis kit (BIO-65042, Bioline, London, UK). Quantitative PCR (RT-qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR of cDNA was performed using MyFi Taq (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... random hexamers primers and Tetro cDNA synthesis kit (Bioline) were used for cDNA synthesis and GAPDH was used as internal control ...
-
bioRxiv - Plant Biology 2020Quote: ... and cDNA was synthesized using Tetro Reverse Transcriptase (Bioline). qRT-PCRs were performed with three technical and three biological replicates ...
-
bioRxiv - Immunology 2020Quote: Tetro cDNA Synthesis Kit (Bioline, Cat. No. BIO-65043) was used to synthesize single-stranded cDNA from 1µg RNA in 12 µL RNAse-free water following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... and cDNA synthesised using oligodT and random hexamers (Bioline). Quantitative PCR was performed on a lightcycler (Roche ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesized using Tetro reverse transcription kit (Bioline) and oligo dT 15-mers (Integrated DNA Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... the cDNA was synthesized using SensiFAST reverse transcriptase (Bioline), and quantitative PCR was run using SensiFAST Sybr Master Mix (Bioline) ...
-
bioRxiv - Molecular Biology 2023Quote: The Tetro cDNA Synthesis Kit (Bioline; BIO-151 65043) was used to transcribe mRNA into cDNA according to the manufacturer’s manual ...
-
bioRxiv - Cell Biology 2021Quote: ... 500 ng of total RNA from each sample were reverse transcribed to cDNA using the Bioline SensiFAST cDNA Synthesis kit (Bioline, Cat# BIO-65054). The cDNA was diluted 13-fold in ddH2O and 4 uL of this dilution was used for each quantitative real-time PCR (qPCR) ...
-
bioRxiv - Plant Biology 2023Quote: ... A total of 1 µg of total RNA was used to initiate cDNA synthesis using the SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK). The SYBR Green assay with SensiFAST™ SYBR no ROX kit was used for the quantification of transcripts in RT-PCR ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time RT–PCR (qRT–PCR) was carried out using the SensiFast™SYBR Hi-ROX One-Step Kit (Bioline) as described (Wobbe et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was set up for each primer set and each primer concentration with the SYBR Hi-ROX Sensimix (Bioline Cat: QT60505) along with melt curve data to check for primer specificity ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using SensiFast cDNA Synthesis Kit (Bioline), and SYBR green PCR analysis was performed using Kapa HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed by Tetro cDNA synthesis kit (Bioline) with the primer of ‘GAGCAAAGACCCCAACGAGA’ targeting MBaMV-GFP genome ...
-
bioRxiv - Neuroscience 2023Quote: ... and reverse transcribed using the SensiFast cDNA Synthesis Kit (Bioline). Quantitative real-time PCR was performed in triplets for each sample using the LightCycler DNA Master SYBR Green I Kit in a LightCycler 480 System (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... The SensiFAST cDNA synthesis kit (Bioline USA Inc., # BIO-65053) was used to synthesize cDNA from 1 µg RNA ...
-
bioRxiv - Neuroscience 2024Quote: ... and reverse-transcribed with the SensiFASTTM cDNA Synthesis Kit (Bioline) to generate cDNA ...