Labshake search
Citations for GE Life Sciences :
2451 - 2500 of 2545 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Bands were detected using HRP-labelled anti-rabbit IgG and developed using an enhanced luminescence kit (GE Healthcare #GENA934, Watford, UK). Beta actin (Sigma #A5316 ...
-
bioRxiv - Microbiology 2021Quote: ... an aliquot of each DNA sample underwent whole genome amplification with the Illustra Ready-To-Go GenomiPhi V3 DNA Amplification Kit (GE Healthcare) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from 1 ml overnight bacterial culture using the Illustra bacteria genomicPrep Mini Spin Kit (GE Healthcare, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Samples of both male and female livers from all the different treatments (N=6-8) were individually used to isolate total RNA via the Illustra RNAspin Mini RNA Isolation kit (GE Healthcare), according to the manufacturer’s standard protocol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Proteins were detected by fluorescence (Odyssey, Li-Cor) or revealed using the ECL Prime Western Blotting Detection Reagent kit (GE Healthcare) and images were acquired in a dark room using a G:Box (Syngene ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from PCRs and agarose gels was purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). Polymerases ...
-
bioRxiv - Evolutionary Biology 2022Quote: Recombinant pGEM-T easy vectors used to sequence the lncov1 full-length were digested with EcoRI (Fermentas) and purified again with the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). In vitro reverse transcription was performed using the RiboMax T7 system (Promega ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The PCR product was gel purified by Illustra GFX PCR DNA and Gel Band Purification Kits (GE Healthcare, Chicago, Illinois, USA), cloned into pJET 1.2/blunt vector (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... blocked for 1 hour and immuno-detected using Anti-RecA (E. coli) antibody (1000x dilution) (gift from Mike Cox, (52)) and analyzed using an ECL Prime detection kit (GE Healthcare). Densitometry was performed using ImageJ (https://imagej.nih.gov/ij/)
-
bioRxiv - Microbiology 2021Quote: ... between 400 to 600 RU of biotinylated anti-IFX monoclonal antibodies were immobilised on a streptavidin-coated sensor chip prepared using the Biotin CAPture kit (GE Healthcare); a biotinylated mouse monoclonal antibody (OX68 ...
-
bioRxiv - Genomics 2021Quote: ... Radiolabeled probes were typically generated by random priming of PCR products covering the regions of interest with Megaprime kit (GE Healthcare) in the presence of α-32P dCTP (3000 Ci/mmol) ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was extracted from rosette leaves of one individual plant using the Nucleon Phytopure genomic DNA extraction kit (GE Healthcare), and whole genome bisulfite sequencing (WGBS ...
-
bioRxiv - Cell Biology 2020Quote: ... A probe was generated from a PCR fragment homologous to the 3’ sequence just outside of the targeted region using the AlkPhos direct labelling kit (GE Healthcare) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... membranes were washed and revealed using a commercial kit (Pierce ECL Western Blotting Substrate, Thermo Fischer) and photos were taken by the ImageQuant LAS 4000 mini (GE Healthcare) camera system ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was extracted from each sample along with the RNA as per manufacturer instructions and amplified using a whole genome amplification kit (illustra GenomePhi v2, GE Healthcare). Sex-specific primers (Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... All blots were washed 4X with PBS-T and then developed with a Amersham ECL Western Blotting Detection Kit (GE Healthcare).
-
bioRxiv - Biochemistry 2022Quote: ... secondary antibodies were incubated for 2 h at room temperature and visualized on X-ray films using enhanced chemiluminescence detection kit (GE Healthcare).
-
bioRxiv - Plant Biology 2022Quote: ... of leaf tissues from M15 plants grown outside under low light conditions using the illustra Nucleon Phytopure Genomic DNA Extraction Kit (GE Healthcare) after grinding the leaves in liquid nitrogen to a fine powder ...
-
bioRxiv - Microbiology 2023Quote: ... Southern blotting to confirm the genotypes were performed using ECL™ Direct Nucleic Acid Labeling and Detection kit (GE Healthcare, USA). Probe (650 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... These primary antibodies were detected using HRP conjugated anti-mouse and anti-rabbit IgGs and the ECL detection kit (all from GE Healthcare). Band intensities were quantified by densitometric analysis with Image Lab software (Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... RNA (5 μg) was used to synthesize the first-strand complementary DNA (cDNA) using the First-Strand cDNA synthesis kit (GE Healthcare) with a pd(N)6 primer following the manufacturer’s indications ...
-
bioRxiv - Molecular Biology 2022Quote: The samples were purified using a minicolumns GFX PCR DNA & gel band purification kit (GE Healthcare Bio-Sciences AB Uppsala, Sweden) according to a previously described protocol (https://dx.doi.org/10.17504/protocols.io.brzpm75n) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the PCR amplified eleven positive virus genomes were amplified by RCA (rolling circle amplification) using the RCA-based TempliPhi DNA amplification kit (GE Healthcare) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5% dextran sulfate) at 65°C probed with 32P-labeled CLB3 DNA probes prepared via Amersham Megaprime DNA labeling kit (GE Healthcare) and Illustra ProbeQuant columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: Gel-purified PCR products were used to generate radio-labeled probes to detect CLN2 and ACT1 mRNAs by Northern blotting (oligonucleotides: TCAAGTTGGATGCAATTTGCAG, TGAACCAATGATCAATGATTACGT; ACT1 oligonucleotides: TCATACCTTCTACAACGA-ATTGAGA and ACACTTCATGATGGAGTTGTAAGT. Probes were labeled using the Megaprime DNA labelling kits (GE Healthcare). Northern blotting was carried out as previously described (Cross and Tinkelenberg ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was isolated from leaf tissue of 4-wk-old plants by using Illustra Nucleon Phytopure extraction kit reagents (GE Healthcare). DNA was isolated from agarose gel pieces using QIAquick gel extraction kit (Qiagen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F1/R1 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and cloned into pJET1.2/blunt cloning vector ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F2/R2 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and directly sequenced.
-
bioRxiv - Biochemistry 2022Quote: ... The antibodies were captured on a CM5 chip immobilized with anti-human IgG Fc using a Human Antibody Capture Kit (GE Healthcare), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: Proteins from the samples were purified by a modified trichloroacetic acid protein precipitation procedure (Clean-Up Kit; GE Healthcare, Munich, Germany), and gel-assisted proteolysis was carried out ...
-
bioRxiv - Biophysics 2023Quote: ... were loaded with 10 μL of Aβ42 oligomer samples alongside the Amersham High Molecular Weight calibration kit for native electrophoresis (GE Healthcare, USA). The gels were run at 4°C using the electrophoresis system according to the Invitrogen instructions (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Detection was performed with the use of Pierce Fast Western Blot Kit in an Amersham Imager 600 (GE Healthcare Life Sciences)..
-
bioRxiv - Microbiology 2024Quote: Single Cononympha cells were collected using a Leica AM6000 micromanipulation system and subjected to whole genome amplification (WGA) using the illustra GenomiPhi V2 kit (GE Healthcare) as described previously [30] ...
-
bioRxiv - Genetics 2024Quote: ... and 5% dextran sulfate) at 65°C probed with 32P-labeled V5 DNA probes prepared via Amersham Megaprime DNA labeling kit (GE Healthcare) and Illustra ProbeQuant columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2024Quote: ... blots incubated with HPR-conjugated secondary antibodies were developed using HRP substrate (EZ-ECL chemiluminescence detection kit for HRP, Geneflow Ltd.) followed by exposure on an ImageQuant chemiluminescent imaging system (GE Healthcare). For blots probed with fluorescent secondary antibodies ...
-
bioRxiv - Systems Biology 2024Quote: ... Antibody bindings were visualized with ECL Prime Western Blotting Detection Reagent kit (Cytiva) and imaged by using ImageQuant LAS500 (GE Healthcare).
-
bioRxiv - Evolutionary Biology 2024Quote: ... we introduced random mutations with Multi Primed Rolling Circle Amplification using the Illustra™ TempliPhi™ DNA Amplification Kit (GE Healthcare) with 2 mM of MnCl2 added to a final reaction volume of 10.8 µl ...
-
bioRxiv - Immunology 2024Quote: ... Detection was performed using an HRP-linked rabbit anti-goat secondary antibody and chemiluminescence detection kit (ECL Plus™, GE Healthcare) using ChemiDoc™ Touch Imaging System (Bio-Rad Laboratories) ...
-
bioRxiv - Immunology 2024Quote: ... An Fc capture chip was produced by amine coupling of anti-mouse IgG antibody to a CM5 chip using a commercial Fc Capture Kit (GE Healthcare). First ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were collected 24 hours post-transfection and the RNA was isolated using the Illustra RNAspin Mini RNA Isolation Kit (GE Healthcare). The pattern of alternative splicing of individual minigenes was detected by RT-PCR assays ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells from 6 wells of each condition were pooled and the RNA extracted using the Illustra RNAspin Mini RNA Isolation Kit (GE Healthcare). The consistency of regulation from T1/T2 and T3/T4 is represented as a scatter plot of GFP (VAR-WT ...
-
bioRxiv - Immunology 2024Quote: ... Dot plots were detected by using the enhanced chemiluminescence detection kit and Image Quant 400 GE Healthcare software (GE Healthcare, Italy) and successively quantified using GS 800 imaging densitometer software (Biorad ...
-
bioRxiv - Physiology 2022Quote: ... at a dilution of 1:2000 was done for 1 hour at RT in blocking buffer and detection was done using ECL detection kit (RPN2235, GE Healthcare, USA). Images were taken by the ImageQuant LAS500 (GE healthcare ...
-
bioRxiv - Genetics 2020Quote: ... High molecular weight DNA from concentrated coral sperm was extracted using the illustra Nucleon Phytopure kit (GE Healthcare Life Science, Pittsburgh, PA) following the manufacturer’s instructions and eluted in nuclease-free water ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA from brain tissues or culture cells were extracted using the illustra RNAspin Mini RNA Isolation Kit (GE Healthcare Life Sciences) for reverse transcription with the High-Capacity cDNA Reverse Transcription Kits (ABI Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... according to manufacturer’s instructions and circular DNA was enriched by rolling circle amplification (RCA) with TempliPhi™ amplification kit (GE Healthcare, USA).
-
bioRxiv - Cell Biology 2022Quote: ... Equal amounts of protein samples were subjected to immunoblotting for target proteins and immunoreactive bands were visualized using the Amersham ECL western blotting detection kit according to the manufacturer’s protocol (GE Healthcare, Piscataway, NJ). Antibodies for GAPDH or Cyclophilin B were used as loading controls.
-
bioRxiv - Genetics 2020Quote: We performed WGA on each F2 gDNA cercarial sample using the Illustra GenomiPhi V2 DNA Amplification kit (GE Healthcare Life Sciences, USA) according to Le Clec’h et al ...
-
bioRxiv - Microbiology 2020Quote: ... extracted DNA was subjected to multiple displacement amplification (MDA) using the illustra GenomiPhi V2 DNA amplification kit (GE Healthcare, Piscataway, NJ, USA), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA from 30–50 light-treated or dark control embryos was extracted using the illustra™ RNAspin Mini kit (GE Healthcare). 1 μg total RNA was used for reverse transcription with qScript XLT cDNA SuperMix (Quantabio) ...