Labshake search
Citations for GE Life Sciences :
1551 - 1600 of 1645 citations for SpectraDye Antibody Labeling Kit IR700 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Bands were detected using HRP-labelled anti-rabbit IgG and developed using an enhanced luminescence kit (GE Healthcare #GENA934, Watford, UK). Beta actin (Sigma #A5316 ...
-
bioRxiv - Microbiology 2021Quote: ... an aliquot of each DNA sample underwent whole genome amplification with the Illustra Ready-To-Go GenomiPhi V3 DNA Amplification Kit (GE Healthcare) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from 1 ml overnight bacterial culture using the Illustra bacteria genomicPrep Mini Spin Kit (GE Healthcare, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Samples of both male and female livers from all the different treatments (N=6-8) were individually used to isolate total RNA via the Illustra RNAspin Mini RNA Isolation kit (GE Healthcare), according to the manufacturer’s standard protocol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Proteins were detected by fluorescence (Odyssey, Li-Cor) or revealed using the ECL Prime Western Blotting Detection Reagent kit (GE Healthcare) and images were acquired in a dark room using a G:Box (Syngene ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from PCRs and agarose gels was purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). Polymerases ...
-
bioRxiv - Evolutionary Biology 2022Quote: Recombinant pGEM-T easy vectors used to sequence the lncov1 full-length were digested with EcoRI (Fermentas) and purified again with the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). In vitro reverse transcription was performed using the RiboMax T7 system (Promega ...
-
bioRxiv - Zoology 2019Quote: The midgut BBMV proteins were subjected to clean-up using the 2-D Clean-up Kit (GE Healthcare Life Sciences, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... phenolics and nucleic acids in extracted protein were removed using the 2-D Clean-Up kit (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The PCR product was gel purified by Illustra GFX PCR DNA and Gel Band Purification Kits (GE Healthcare, Chicago, Illinois, USA), cloned into pJET 1.2/blunt vector (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... as capture molecule to the dextran surface of both flow cells of a CM5 Chip (GE Heathcare) using an amine coupling kit (GE healthcare). GST tagged ligand proteins were captured on the detection flow cell of the chip and free GST was captured on the reference flow cell ...
-
bioRxiv - Immunology 2019Quote: ... rVACV-eGFP-OVA-Early and rVACV-eGFP-OVA-Late were generated by transfecting plasmid DNA into BSC-1 cells infected with VACV-vRB21 at an MOI of 1 using the CellPhect Transfection Kit (GE Healthcare). The resulting rVACVs were plaque-purified 3× prior to characterization ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was excised from the gels and extracted using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Radiolabeled probes were typically generated by random priming of PCR products covering the regions of interest with Megaprime kit (GE Healthcare) in the presence of α-32P dCTP (3000 Ci/mmol) ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was extracted from rosette leaves of one individual plant using the Nucleon Phytopure genomic DNA extraction kit (GE Healthcare), and whole genome bisulfite sequencing (WGBS ...
-
bioRxiv - Cell Biology 2020Quote: ... A probe was generated from a PCR fragment homologous to the 3’ sequence just outside of the targeted region using the AlkPhos direct labelling kit (GE Healthcare) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... membranes were washed and revealed using a commercial kit (Pierce ECL Western Blotting Substrate, Thermo Fischer) and photos were taken by the ImageQuant LAS 4000 mini (GE Healthcare) camera system ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was extracted from each sample along with the RNA as per manufacturer instructions and amplified using a whole genome amplification kit (illustra GenomePhi v2, GE Healthcare). Sex-specific primers (Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... All blots were washed 4X with PBS-T and then developed with a Amersham ECL Western Blotting Detection Kit (GE Healthcare).
-
bioRxiv - Biochemistry 2022Quote: ... secondary antibodies were incubated for 2 h at room temperature and visualized on X-ray films using enhanced chemiluminescence detection kit (GE Healthcare).
-
bioRxiv - Plant Biology 2022Quote: ... of leaf tissues from M15 plants grown outside under low light conditions using the illustra Nucleon Phytopure Genomic DNA Extraction Kit (GE Healthcare) after grinding the leaves in liquid nitrogen to a fine powder ...
-
bioRxiv - Molecular Biology 2022Quote: ... the membrane was hybridized with a random-primed 32P-labeled specific probe using Amersham™ Megaprime kit (GE Healthcare, Cat# RPN1607). The probe was obtained from a 1.45 kb PCR product (primers list in Table S3 ...
-
bioRxiv - Molecular Biology 2022Quote: The samples were purified using a minicolumns GFX PCR DNA & gel band purification kit (GE Healthcare Bio-Sciences AB Uppsala, Sweden) according to a previously described protocol (https://dx.doi.org/10.17504/protocols.io.brzpm75n) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the PCR amplified eleven positive virus genomes were amplified by RCA (rolling circle amplification) using the RCA-based TempliPhi DNA amplification kit (GE Healthcare) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Gel-purified PCR products were used to generate radio-labeled probes to detect CLN2 and ACT1 mRNAs by Northern blotting (oligonucleotides: TCAAGTTGGATGCAATTTGCAG, TGAACCAATGATCAATGATTACGT; ACT1 oligonucleotides: TCATACCTTCTACAACGA-ATTGAGA and ACACTTCATGATGGAGTTGTAAGT. Probes were labeled using the Megaprime DNA labelling kits (GE Healthcare). Northern blotting was carried out as previously described (Cross and Tinkelenberg ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was isolated from leaf tissue of 4-wk-old plants by using Illustra Nucleon Phytopure extraction kit reagents (GE Healthcare). DNA was isolated from agarose gel pieces using QIAquick gel extraction kit (Qiagen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F1/R1 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and cloned into pJET1.2/blunt cloning vector ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F2/R2 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and directly sequenced.
-
bioRxiv - Neuroscience 2023Quote: Proteins from the samples were purified by a modified trichloroacetic acid protein precipitation procedure (Clean-Up Kit; GE Healthcare, Munich, Germany), and gel-assisted proteolysis was carried out ...
-
bioRxiv - Biophysics 2023Quote: ... were loaded with 10 μL of Aβ42 oligomer samples alongside the Amersham High Molecular Weight calibration kit for native electrophoresis (GE Healthcare, USA). The gels were run at 4°C using the electrophoresis system according to the Invitrogen instructions (ThermoFisher Scientific ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we introduced random mutations with Multi Primed Rolling Circle Amplification using the Illustra™ TempliPhi™ DNA Amplification Kit (GE Healthcare) with 2 mM of MnCl2 added to a final reaction volume of 10.8 µl ...
-
bioRxiv - Plant Biology 2024Quote: ... Immunodetection was performed using an ECL Plus Western Detection Kit and revealed with an ImageQuant LAS 4000 mini CCD camera system (GE Healthcare). ImageJ was used for quantifications of the bands.
-
bioRxiv - Neuroscience 2024Quote: ... RNA (5 μg) was used to synthesize the first-strand complementary DNA (cDNA) using the First-Strand cDNA synthesis kit (GE Healthcare) with a pd(N)6 primer following the manufacturer’s indications ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies used were peroxidase-linked anti-mouse IgG and peroxidase-linked anti-rabbit IgG (both Cytiva, formerly known as GE Healthcare Bio-Sciences, NA931 and NA934; 1:5000), Alexa Fluor 594-conjugated donkey anti-mouse IgG (1:250 ...
-
bioRxiv - Physiology 2022Quote: ... at a dilution of 1:2000 was done for 1 hour at RT in blocking buffer and detection was done using ECL detection kit (RPN2235, GE Healthcare, USA). Images were taken by the ImageQuant LAS500 (GE healthcare ...
-
bioRxiv - Genetics 2020Quote: ... High molecular weight DNA from concentrated coral sperm was extracted using the illustra Nucleon Phytopure kit (GE Healthcare Life Science, Pittsburgh, PA) following the manufacturer’s instructions and eluted in nuclease-free water ...
-
bioRxiv - Cell Biology 2019Quote: ... 6His-Cdc11-SNAP was biotinylated with BG-Biotin and subsequently immobilized on a CAP chip (Biotin Capture Kit; GE Healthcare, Freiburg, Germany). Preparation of the chip ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA from brain tissues or culture cells were extracted using the illustra RNAspin Mini RNA Isolation Kit (GE Healthcare Life Sciences) for reverse transcription with the High-Capacity cDNA Reverse Transcription Kits (ABI Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... according to manufacturer’s instructions and circular DNA was enriched by rolling circle amplification (RCA) with TempliPhi™ amplification kit (GE Healthcare, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were further washed three times for five minutes in PBS-T before being visualised using ECL kit (GE Healthcare Cat. #RPN2232) and ChemiDoc Imaging System (BioRad) ...
-
bioRxiv - Cell Biology 2022Quote: ... Equal amounts of protein samples were subjected to immunoblotting for target proteins and immunoreactive bands were visualized using the Amersham ECL western blotting detection kit according to the manufacturer’s protocol (GE Healthcare, Piscataway, NJ). Antibodies for GAPDH or Cyclophilin B were used as loading controls.
-
bioRxiv - Genomics 2019Quote: ... and whole genome amplification was achieved by multiple displacement amplification with Phi29 DNA polymerase and the Illustra GenomiPhi v.2 kit (GE Healthcare, 25660032). Amplified genomic DNA (70 ng ...
-
bioRxiv - Molecular Biology 2019Quote: ... random hexamer primers were used following the manufacturer’s instructions for the GenomiPhi V2 DNA Amplification Kit (catalogue # 45-001-221, GE Healthcare Life Sciences).
-
bioRxiv - Genetics 2020Quote: We performed WGA on each F2 gDNA cercarial sample using the Illustra GenomiPhi V2 DNA Amplification kit (GE Healthcare Life Sciences, USA) according to Le Clec’h et al ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were developed using the ECL Prime kit (Cytiva, Marlborough, MA) and imaged using Amersham Imager 600 (GE Healthcare, Amersham, Buckinghamshire, UK). Fractionation was repeated with 3 independent sets of cultures and one set of immunoblots is presented as a representative.
-
bioRxiv - Microbiology 2020Quote: ... extracted DNA was subjected to multiple displacement amplification (MDA) using the illustra GenomiPhi V2 DNA amplification kit (GE Healthcare, Piscataway, NJ, USA), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA from 30–50 light-treated or dark control embryos was extracted using the illustra™ RNAspin Mini kit (GE Healthcare). 1 μg total RNA was used for reverse transcription with qScript XLT cDNA SuperMix (Quantabio) ...
-
bioRxiv - Immunology 2021Quote: ... 10μg/mL of C-terminal 6X-His tag containing recombinant SARS-CoV-2 Spike protein was captured at a flow rate of 10μL/minute for 180 seconds onto carboxymethylated (CM5) dextran sensor chips immobilised with anti-His mAb using EDC/NHS amine coupling kit (GE Healthcare, Australia). The sensor chips were equilibrated with running buffer [HEPES buffer (HBS-EP+ ...
-
bioRxiv - Genomics 2021Quote: Single-cell WGA was done on 10~17 μm or 17~25 μm C1 DNA-Seq IFC (Fluidigm, 100-5763 or 100-5764) via multiple displacement amplification method using illustra GenomiPhi V2 DNA Amplification Kit (GE Healthcare, 25660031). The WGA products from single cells were mixed according to their tissue origin ...
-
bioRxiv - Molecular Biology 2022Quote: ... The probes (PCR amplified from gDNA or binary plasmid using the oligos in Supplemental Table S3) were internally labelled using [α-P32] dCTP (BRIT India) using Rediprime labelling kit (GE healthcare) and hybridisation and washes were performed as described ...