Labshake search
Citations for IDT DNA :
101 - 150 of 244 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... The RNP was made by incubating gRNA and High Fidelity Cas9 protein (Integrative DNA Technologies, USA) at a molar ratio of 1:2 at 37 °C for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... tracrRNA (IDT DNA, 0.5μL at 100μM) and crRNA(s ...
-
bioRxiv - Cell Biology 2022Quote: ... and crRNA(s) for the target (IDT DNA, 2.7μL at 100μM) with duplex buffer (IDT DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... with duplex buffer (IDT DNA, 2.8μL) were annealed together (5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... and eluted in 15 μL of IDTE buffer (IDT DNA). 1 μL of this purified product was used for PCR-3 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Guides were chosen considering efficiency predictions of the IDT DNA CRISPR-Cas9 guide checker and ChopChopV2 (109) on the zebrafish assembly danRer7 and ordered as Alt-R CRISPR-Cas crRNA from IDT DNA. For each line ...
-
bioRxiv - Cell Biology 2022Quote: ... All reagents were from IDT DNA.
-
bioRxiv - Biophysics 2022Quote: ... were purchased from IDT DNA. These 51 positions were chosen to avoid mutations to Pro ...
-
bioRxiv - Genetics 2022Quote: ... and an siRNA for Lig4 (IDT DNA). The same siRNA was used for D ...
-
bioRxiv - Molecular Biology 2022Quote: Electrophoretic mobility shift assays were performed with different competitor DNA (ssDNA-salmon sperm DNA) conditions than SELEX-seq using Fam-labled dsDNA probes were generated by annealing upper fam labeled oligos (IDT DNA, Supplementary table 1). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... using the PrimeTime Gene Expression Master Mix (IDT DNA) and the following mouse primers ...
-
bioRxiv - Bioengineering 2022Quote: ... All DNA sequences were purchased from IDT DNA Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5μL at 10mg/mL), annealed crRNA ...
-
bioRxiv - Genetics 2022Quote: ... end-repaired and A-tailed DNA fragments were ligated to IDT for Illumina UDI Adapters (IDT DNA Inc.). Quality and quantity of the finished libraries were assessed using a combination of Agilent DNA High Sensitivity chip (Agilent Technologies) ...
-
bioRxiv - Genetics 2022Quote: ... cDNA fragments were ligated to IDT for Illumina unique dual adapters (IDT DNA Inc). Quality and quantity of the finished libraries were assessed using a combination of Agilent DNA High Sensitivity chip (Agilent Technologies) ...
-
bioRxiv - Bioengineering 2022Quote: Oligonucleotides were purchased from IDT DNA. Fluorophore-labeled strands were purified to high-performance liquid chromatography (HPLC ...
-
bioRxiv - Microbiology 2022Quote: ... Primers used for mutagenesis can be found in Table S2 and purchased from IDT DNA Technologies (Coralville ...
-
bioRxiv - Microbiology 2022Quote: ... Barcoded primers were purchased from IDT DNA. The primer sequences are listed in Supplementary data (Sequences of the barcoded_primers.xlsx).
-
Inhibition of major histocompatibility complex-I antigen presentation by sarbecovirus ORF7a proteinsbioRxiv - Microbiology 2022Quote: ... annotated in the viral genome (GenBank accession MN985325 (13)) and (14)) were human codon-optimized using GenSmart™ Codon Optimization and synthesized by IDT DNA Technologies as gBlocks ...
-
bioRxiv - Immunology 2022Quote: ... using the PrimeTime Gene Expression Master Mix (IDT DNA) and the following mouse primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... To create the pME-zAgRP1 construct for gateway cloning, the cDNA sequence was obtained from (Song et al., 2003) and ordered as a gBlock Gene Fragment (IDT DNA, Coralville IA USA), PCR amplified using AccuPrime Taq DNA Polymerase High Fidelity (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... The second fragment was synthesized as a gBlock (Integrative DNA Technologies) consisting of 5’-XhoI – simian virus 40 nuclear localization sequence (- TCATCCGATGACGAGGCCACAGCTGATTCCCAGCACTCAACTCCGCCTAAAAAAAAAAGAA AAGTT ...
-
bioRxiv - Biophysics 2022Quote: DNA sequences with 5’ lipids were custom ordered from IDT DNA. DNA Sequence ‘C’ used to tether liposomes is /5DPPEK/TA GTA TTC AAC ATT TCC GTG TCGA and complementary DNA sequence ‘D’ incorporated in viral particles is /5DPPEK/TT TTT TTT TTT TTT TTT TTTTTT TTC GAC ACG GAA ATG TTG AAT ACTA with T24 linker as previously used (21) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the Cas9:crRNA:tracrRNA ribonucleoprotein (RNP) complex was assembled according to the manufacturer’s recommendations (IDT DNA) and transfected into the cells using Lipofectamine RNAiMAX reagent (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... These assembled BCR sequences were synthesized into GeneBlocks (IDT DNA) and then cloned in the pTRIOZ-hIgG1 plasmid (InvivoGen ...
-
bioRxiv - Cell Biology 2022Quote: ... The final injection mix containing Cas9 (IDT DNA, 0.5 ul at 10mg/ml), annealed crRNA and tracrRNA along with the repair template for the mutation and a co-CRISPR marker (unc-58 or dpy-10 ...
-
bioRxiv - Cell Biology 2022Quote: ... and crRNA(s) (IDT DNA, 2.7ul at 100uM) were combined in duplex buffer (IDT DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... were combined in duplex buffer (IDT DNA, 2.8 ul), annealed together (5 mins ...
-
bioRxiv - Cell Biology 2022Quote: ... tracrRNA (IDT DNA, 0.5 μl at 100 μM) and crRNA(s ...
-
bioRxiv - Cell Biology 2022Quote: ... tracrRNA (IDT DNA, 0.5 μl at 100 μM) and designed crRNA(s ...
-
bioRxiv - Cell Biology 2022Quote: ... with duplex buffer (IDT DNA, 2.75ul) were annealed together (5mins ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5 μl at 10 mg/ml), annealed crRNA and tracrRNA along with the repair template was incubated at 37°C for 15 minutes before the debris in the mix was pelleted (15 mins ...
-
bioRxiv - Cell Biology 2022Quote: ... and designed crRNA(s) for the target (IDT DNA, 2.75 μl at 100 μM) with duplex buffer (IDT DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... Mutated enhancers were custom synthesized as gene blocks (gBlocks, IDT DNA) (Supplementary Table 3 ...
-
bioRxiv - Bioengineering 2022Quote: ... All oligos and lipid oligos were ordered as custom syntheses (Integrative DNA Technologies), resuspended to either 5 mM (photopatterning ssDNA ...
-
bioRxiv - Genetics 2022Quote: ... All CRISPR-Cas9 reagents (crRNAs, tracrRNAs, Cas9, Cat# 1081058) were obtained from IDT DNA (Coralville, IA). Locus-specific crRNAs were selected using a combination of rating algorithms from IDT DNA and CRISPRscan.73 Candidate crRNAs that scored at least 40 (range 0-100 ...
-
bioRxiv - Genetics 2022Quote: ... Locus-specific crRNAs were selected using a combination of rating algorithms from IDT DNA and CRISPRscan.73 Candidate crRNAs that scored at least 40 (range 0-100 ...
-
bioRxiv - Plant Biology 2022Quote: ... Primers were synthesized from IDT DNA, USA ...
-
bioRxiv - Plant Biology 2022Quote: ... All primers and probes were synthesized by Integrative DNA Technologies.
-
bioRxiv - Physiology 2022Quote: ... Primers were designed for gene specificity and to cross exon-exon junctions using Primer-BLAST (www.ncbi.nlm.nih.gov/tools/primer-blast/) and purchased from IDT DNA Technologies (Coralville ...
-
bioRxiv - Physiology 2022Quote: ... Custom GeneBlocks (IDT DNA) were synthesized containing the predicted PPRE sites for G23Rik (Table S1) ...
-
bioRxiv - Microbiology 2022Quote: ... mAID-coding sequence was first synthesized (IDT DNA gBlock) and cloned into a pBluescript SK vector ...
-
bioRxiv - Microbiology 2022Quote: ... The relative quantities of envelope (E) gene were measured using SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT DNA technologies). Relative quantities of E gene were normalized to GAPDH mRNA levels (Applied Bioscience ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribonucleoprotein complex (RNP) were prepared by annealing 20 µM crRNA with 20 µM tracrRNA (IDT DNA) at 95°C ...
-
bioRxiv - Immunology 2022Quote: ... as well as 20 mM electroporation enhancer (IDT DNA). RNPs were incubated for 15 min at RT and directly used for electroporation.
-
bioRxiv - Immunology 2022Quote: ... 24 mM high fidelity Cas9 (IDT DNA) was added slowly to gRNA solution to yield RNPs with 12 mM Cas9 and 20 mM gRNA ...
-
bioRxiv - Immunology 2022Quote: ... and 80 mM crRNA (IDT DNA) were incubated at 95°C for 5 min ...
-
bioRxiv - Immunology 2022Quote: ... 80 mM tracrRNA (IDT DNA) and 80 mM crRNA (IDT DNA ...
-
bioRxiv - Neuroscience 2022Quote: ... oligonucleotide primers for generating an ISH template (IDT DNA) were ordered commercially [similar to Bautista et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... Index primers were ordered from Integrative DNA Technology. PCR was set up with the following conditions ...