Labshake search
Citations for IDT DNA :
51 - 100 of 244 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized as gBlocks (Integrative DNA Technologies). The CDS for nsp9 was amplified from a mammalian expression vector (a gift from N ...
-
bioRxiv - Biophysics 2024Quote: The UG repeats (UG)4: rUGrUGrUGrUG and (UG)6: rUGrUGrUGrUGrUGrUG were purchased from IDT DNA. The UG repeats ((UG)n ...
-
bioRxiv - Bioengineering 2024Quote: The primers used for mutations were synthesized by IDT DNA. BL21(DE3 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... ordered as Custom DsiRNAs with standard purification (IDT DNA Technologies), resuspended at 100 μM in 1X Bombyx injection buffer (pH 7.2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... ordered at the 2 nmol scales as Custom DsiRNAs with standard purification (IDT DNA Technologies), resuspended at 100 μM in 1x Bombyx injection buffer (pH 7.2 ...
-
bioRxiv - Cell Biology 2024Quote: The barcoding cassette used in this study were constructed by incorporating gBlock (IDT DNA) synthesized DNA fragments ...
-
bioRxiv - Developmental Biology 2024Quote: ... All oligos were purchased from IDT DNA Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... the full-length codon optimized gene with N-terminal 6x-His-sequnce and NdeI-XhoI sites was synthesized (IDT DNA Inc.) (Table S2) ...
-
bioRxiv - Biophysics 2023Quote: ... Sequence was verified by nucleotide sequencing (IDT DNA, I). AChRs were transiently expressed in HEK 293 cells by transfecting (CaPO4 precipitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CY5) were selected as recommended by the PrimeTime Multiplex Dye Selection tool (web tool available from IDT DNA). Reference sequences for primer design were obtained from GenBank (Clark ...
-
bioRxiv - Molecular Biology 2023Quote: ... crRNA and trRNA (1:1) were complexed using touchdown polymerase chain reaction (PCR) (IDT DNA Technologies), and Cas9 3NLS protein (IDT DNA Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... an insert (derived from G-block #13; IDT DNA) carrying 102 bp of the φ10 promoter sequence (identical to the sequence found in pTF1 (ATCC 77397) ...
-
bioRxiv - Immunology 2023Quote: ... Primary probes for iterative smFISH were obtained as a pool that contained equimolar amounts of each of the 358 oligonucelotides from IDT DNA (Supplementary Table 1). Readout probes were obtained with 3’ amino moieties and coupled to either Texas Red or Cy5 and purifed by HPLC like smFISH probes ...
-
bioRxiv - Bioengineering 2023Quote: ... We next synthesized a Geneblock (IDT DNA Technologies) containing a human codon-optimized version of a PCSK1/3-P2A-CD19Δ-mScarlet and inserted it into the NheI/EcoRI sites to complete the donor vector (Figure S1) ...
-
bioRxiv - Neuroscience 2023Quote: ... Candidate probe sequences were ordered from IDT DNA oPool (Table S11).
-
bioRxiv - Microbiology 2023Quote: ... mAID-coding sequence was first synthesized (IDT DNA gBlock) and cloned into a pBlueScript SK vector ...
-
bioRxiv - Bioengineering 2023Quote: ... high fidelity Cas9 (IDT DNA) at a final concentration of 3 μM and electroporation enhancer (IDT DNA ...
-
bioRxiv - Bioengineering 2023Quote: ... at a final concentration of 3 μM and electroporation enhancer (IDT DNA) at a final concentration of 30 μM were added to the gRNA mix ...
-
bioRxiv - Bioengineering 2023Quote: ... 80 μM crRNA (IDT DNA) and 80 μM crRNA (IDT DNA ...
-
bioRxiv - Bioengineering 2023Quote: ... and 80 μM crRNA (IDT DNA) were incubated 5 min at 95°C ...
-
bioRxiv - Biophysics 2023Quote: ... Oligonucleotides were obtained from Integrative DNA Technologies (Coralville, IA) and Biosearch Technologies (Hoddesdon ...
-
bioRxiv - Microbiology 2023Quote: ... The primers used in this study were synthesized by IDT DNA Technologies and are described in Table S5 ...
-
bioRxiv - Biophysics 2023Quote: ... 5’ primer with homology to linker DNA upstream of ∼60 bp of pericentromeric DNA and the centromere (SB7843) and a 5’-biotinylated (IDT DNA) 3’ primer with linker DNA ...
-
bioRxiv - Biophysics 2023Quote: ... DNA templates were generated by PCR using a 5’-ATTO647-funtionalized (IDT DNA) 5’ primer with homology to linker DNA upstream of ∼60 bp of pericentromeric DNA and the centromere (SB7843 ...
-
bioRxiv - Genomics 2023Quote: ... 25 µM annealed ChAR-seq bridge (top strand: /5rApp/AANNNAAACCGGCGTCCAAGGATCTTTAATTAAGTCGCAG/3SpC3/; bottom strand: /5Phos/GATCTGCGACTTAATTAAAGATCCTTGGACGCCGG/iBiodT/T; individual strands ordered from IDT DNA) ...
-
bioRxiv - Plant Biology 2023Quote: ... a gblock containing the WY domain of PexRd54 of corresponding length to the Pi04314 WY domain (residues 68 – 131) and the C-terminal KVxF loop of Pi04314 (residues 132 – 154) was synthesized (IDT DNA) with In-Fusion Cloning sites to allow cloning into pOPIN-S3C.
-
bioRxiv - Microbiology 2023Quote: ... All primers were ordered from IDT DNA (Table S3).
-
bioRxiv - Synthetic Biology 2023Quote: ... These plasmids were constructed by isothermal assembly of G-Blocks (IDT DNA) or PCR fragments ...
-
bioRxiv - Genetics 2023Quote: ... the Sc2A10 coding sequence and intronic 3xP3-GFP-Tub56D marker cassette were ordered as synthetic DNA gBlocks (IDT DNA, Belgium) flanked by appropriate BsaI restriction sites ...
-
Constitutive and conditional epitope-tagging of endogenous G protein coupled receptors in DrosophilabioRxiv - Neuroscience 2023Quote: ... CRISPR sgRNA sequences were ordered as DNA oligos (IDT DNA, Coralville, IA), phosphorylated in vitro ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Gal4 response elements (5xGRE) were synthesised (IDT DNA) with ClaI/AscI overhangs and cloned into Cla/AscI digested pLV-REPORT(PGK/CMV) ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was conducted to confirm the genotype of double or triple mutants using primers purchased from IDT DNA. Primers are listed in the Table 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were generated using the Alt-R CRISPR-Cas9 System (IDT DNA Technologies) following the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Physiology 2023Quote: ... Knockdown experiments used dicer-substrate siRNA (IDT DNA) against BCKDHA ...
-
bioRxiv - Bioengineering 2023Quote: ... and Fluorophore-quencher labeled reporter were purchased from Integrated DNA Technologies (IDT DNA). The single-stranded reporter DNA was constructed with a 5 nucleotide sequence ...
-
bioRxiv - Microbiology 2023Quote: FapA gene block was ordered from Twist Bioscience and primers (IDT DNA) were used to clone into pET32 vector using In-fusion cloning mechanism (Takara Bio) ...
-
bioRxiv - Cell Biology 2023Quote: ... and synthesized (gBlock, IDT DNA) with a nuclear export signal (LALKLAGLDI)92 and p2A sequence appended.
-
bioRxiv - Systems Biology 2023Quote: ... and ordered from IDT DNA technologies ...
-
bioRxiv - Immunology 2023Quote: ... Control cells were transfected with the nuclease duplex buffer from IDT DNA (USA) instead of crRNA.
-
bioRxiv - Immunology 2023Quote: ... 3.3 μM of sgRNA were incubated with Alt-R HiFi Cas9 Nuclease V3 (IDT DNA (USA) at 0.27 mg/mL and Alt-R HDR electroporation enhancer at 5 μM and then transfected into cells by using the Neon Electroporation System (Thermofisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... Crispr RNA (crRNA) and tracer RNA (trRNA) were purchased from IDT DNA Technologies (Coralville ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA oligonucleotides were synthesized by IDT DNA and cloned into the lentiCRISPRv2 vector46 for lentivirus production ...
-
bioRxiv - Biophysics 2023Quote: ... all the DNA oligonucleotides were ordered with 5’-modification of Alexa Flour 488 fluorophore (from IDT DNA, Supplementary Table I).
-
bioRxiv - Biochemistry 2023Quote: ... Gene blocks of MMP-9Cat variants Des 3 and Des 4 were purchased from IDT DNA, USA ...
-
bioRxiv - Biochemistry 2023Quote: The primers containing mutation (mutagenesis primers) for Des1 and Des2 were designed and purchased from Integrated DNA Technologies (IDT DNA, USA) and cloned into pET28 plasmids using the Transfer PCR protocol (TPCR ...
-
bioRxiv - Developmental Biology 2023Quote: ... ordered at the 2 nmol or 10 nmol scales as Custom DsiRNAs with standard purification (IDT DNA Technologies), resuspended at 70-100 μM in 1X Bombyx injection buffer (pH 7.2 ...
-
bioRxiv - Microbiology 2023Quote: Primers (Table S1) synthesized by Integrative DNA Technologies were designed that amplified on either side of the antibiotic resistance cassette that was to be removed ...
-
bioRxiv - Microbiology 2023Quote: ... or by PCR amplification of a synthesized gblock (IDT DNA technologies) for the ΔhsdS mutant ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Cas9 3NLS protein (IDT DNA Technologies) was added to make functional ribonucleoprotein (RNP) ...
-
bioRxiv - Immunology 2022Quote: ... Taqman PCR was performed with conditions according to the manufacturer’s instructions (IDT DNA) on the ViiA 7 system (Applied Biosystems) ...