Labshake search
Citations for Millipore Sigma :
101 - 150 of 2392 citations for bta mir 486 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... amplified with the primers P2 and P3 (S2 Table) by KOD PCR (Sigma-Aldrich). Transfected parasites were selected in medium containing mycophenolic acid (25 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... miR-325 and control miRNA were purchased from Sigma-Aldrich.
-
bioRxiv - Cell Biology 2022Quote: ... Newly eclosed adults were kept for an additional 1–2 days before inducing transcription activation by placement on food containing the steroid hormone mifepristone (RU-486; Sigma M8046) in a 25 μg/ml concentration and flipped every 2 days thereafter ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primers are from Sigma (KiCqStartTM Primers).
-
bioRxiv - Plant Biology 2022Quote: All primers (Sigma Aldrich UK. Primers) for gene targets (Supplementary Table S1) ...
-
bioRxiv - Cell Biology 2021Quote: ... qRT-PCR was performed with Kicqstart One-Step Probe RT-qPCR ReadyMix (KCQS07; Sigma). Inventoried TaqMan probes for qRT-PCR from Applied Biosystems were used for human TULP3 and GAPDH ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative RT-PCR was carried out using SYBR Green (Jumpstart Taq ReadyMix: Sigma-Aldrich) in 10 μl volumes for 3 biological and 3 technical replicates with 1:10 diluted cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR was performed using FastStart Universal SYBR Green Master (Rox) (Sigma, 4913850001) on a Bio-Rad CFX Connect Real-Time PCR detection system ...
-
bioRxiv - Immunology 2023Quote: ... IL10 and normalization control GAPDH were examined by RT-qPCR using gene specific primers (Sigma Aldrich, St. Louis, MO, USA) as previously described 11 ...
-
bioRxiv - Biochemistry 2021Quote: ... the Msm guaB1 gene was amplified by PCR by primer pair 17/18 and inserted into the PCR-linearized pTriex-4 vector (Novagen, USA) with primers 15/16 by the In-Fusion approach ...
-
bioRxiv - Genomics 2020Quote: ... Sequences were PCR amplified from zebrafish genomic DNA using the primers in SupplementaryTable16 (Sigma-Aldrich), with the proof-reading iMax ™ II DNA polymerase (INtRON Biotechnology ...
-
bioRxiv - Molecular Biology 2019Quote: ... using PCR primers Ad1_noMX and Ad2_Barcode (Sigma-Aldrich, see Table 2, (Buenrostro et al., 2013) for 5 initial cycles (1 cycle ...
-
bioRxiv - Immunology 2022Quote: ... cDNAs were mixed with indicated gene-specific primers and SYBR green PCR Master Mix (Sigma), and qRT-PCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR system.
-
bioRxiv - Physiology 2023Quote: ... and included predesigned primers (Sigma KiQStart Primers). Gene expression was normalized using housekeeping genes β-ACTIN ...
-
bioRxiv - Cancer Biology 2020Quote: ... Phosphatase inhibitor cocktail set II and protease inhibitor cocktail set III (EMD Millipore) were added at the time of lysis ...
-
bioRxiv - Developmental Biology 2023Quote: ... TgBAC(cxcr4b:LexPR-LexOP:Arhgef11-T2A-H2A-TagBFP)] and control sibling embryos were dechorionated at 24 hpf and incubated in fish water with either RU-486 (final concentration 1 μM, Millipore Sigma, catalog # M8046) or ethanol until 48 hpf ...
-
bioRxiv - Biophysics 2022Quote: ... sub-cloned into the pNKS2 vector) via PCR with custom-designed primers (Eurofins Genomics, Sigma-Aldrich) and PfuUltra II Fusion HS DNA polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: TRPM8 sequences were amplified by PCR using the following primers (ordered from Millipore Sigma, Burlington, MA):
-
bioRxiv - Cancer Biology 2023Quote: ... Hsa-miR-203 mimics were purchased from Sigma Aldrich (MISSION microRNA mimics) and transient transfection was performed using Lipofectamine 2000 (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primers (Sigma) were designed with PrimeTime (https://eu.idtdna.com/scitools/Applications/RealTimePCR/) ...
-
bioRxiv - Microbiology 2019Quote: ... Primers (Sigma) used are shown in Extended Table 2 ...
-
bioRxiv - Immunology 2021Quote: ... Primers (Sigma) used were as follows:
-
bioRxiv - Cancer Biology 2021Quote: ... Primers (Sigma) are listed in Supplementary Table No ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Primers (Sigma) included type IIS restriction sites for later cloning ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers (Sigma) were designed on different exons to avoid the amplification of genomic DNA (Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR analysis was performed using the KAPA SYBR Fast PCR master mix (Sigma Aldrich, #KK4605) or SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... RT-PCR on both gDNA and cDNA was performed using the SYBR® Green JumpStart (Sigma) in a 7500 Fast Real Time PCR cycler from Applied Biosystems.
-
bioRxiv - Bioengineering 2022Quote: ... They were allocated to 4 cohorts (20 flies of each) and transferred to the fresh food with RU-486 (Sigma, Cat #: 84371-65-3) added at a final concentration of 200 μM and raised in 25°C to allow the Gal4-UAS system function well ...
-
bioRxiv - Immunology 2023Quote: ... with predesigned primers (Sigma-Aldrich, KiCqStart SYBR Green Primers) specific for murine Il10 ...
-
bioRxiv - Genetics 2021Quote: ... qRT-PCR was performed using gene-specific primers (Table S3) with Kapa SyBr Fast (Sigma-Aldrich, #KK4618) in an Applied Biosystem ViiA 7 real-time PCR system.
-
bioRxiv - Bioengineering 2019Quote: ... PCR was performed using control primers beyond the homology regions with KODXtreme Taq polymerase (Millipore, Massachusetts, USA). Where indicated ...
-
bioRxiv - Developmental Biology 2023Quote: ... qRT-PCR was performed on Bio-Rad CFX96 real time (qPCR) system using predesigned KiCqstart primers (Sigma) and TBB green (#RR-208A ...
-
bioRxiv - Cancer Biology 2019Quote: ... The transfecting miR-590-5p mimics and inhibitors were obtained from Sigma-Aldrich, and the negative control (NC ...
-
bioRxiv - Microbiology 2020Quote: We performed reverse transcription using the First strand cDNA synthesis kit for RT-PCR (AMV) (Sigma-Aldrich) and the protocol described by the supplier ...
-
bioRxiv - Microbiology 2020Quote: ... presence of enzyme inhibitors in RNA extracts was assessed by reverse transcription PCR (eAMV RT, Sigma-Aldrich) using universal primers for 18S RNA ...
-
bioRxiv - Microbiology 2020Quote: For real-time quantitative reverse transcription PCR (RT-qPCR) total cellular RNA was extracted with Trizol (Sigma) or QiAmp (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: Quantitative real-time PCR (rt-qPCR) was carried out using the KAPA SYBR® FAST Mix (Sigma) on a LightCycler 480 (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2021Quote: Genomic DNA was extracted from tail tissues and amplified with specific PCR primers using REDExtract-N-Amp™ Tissue PCR kit (Cat. No. XNAT-100RXN, Sigma-Aldrich, Saint Louis, MO) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% protease inhibitor cocktail set III and 1% phosphatase inhibitor cocktail set IV (EMD Millipore Corporation). Cells were scraped ...
-
bioRxiv - Molecular Biology 2019Quote: ... Set III Protease Inhibitor Cocktail (Millipore) 1:100 ...
-
bioRxiv - Immunology 2021Quote: ... Specific primers were purchased from Sigma (KiCqStart SYBR Green Primers) for the detection of the different genes ...
-
bioRxiv - Immunology 2022Quote: ... and predesigned primers obtained from Sigma-Aldrich (KiCqStart® Primers). The presented relative gene expression levels were calculated using the 2−ΔΔCT method (Livak and Schmittgen ...
-
bioRxiv - Microbiology 2024Quote: ... qRT-PCR reaction mixtures were set up with 10 µl of SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma-Aldrich), 2 µl primers (final concentration 1 µM) ...
-
bioRxiv - Biophysics 2020Quote: ... Single- and double-mutant constructs of hERG were produced using conventional overlap PCR with primers synthesized by Sigma Genosys (Oakville ...
-
bioRxiv - Microbiology 2022Quote: ... tuberculosis H37Rv genomic DNA by polymerase chain reaction (PCR) using primers that were synthesized by Sigma (Table S3). Hybrid combinations of genes or introduction of affinity tags were achieved with the use of nested primers ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative PCR was performed for the amplification of cDNAs using the appropriate primers (Sigma-Aldrich, see Table S2) and the GoTaq® qPCR Master Mix (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: qPCR (q-PCR) primers were designed using Universal probe library Assay Design Center and were purchased from Sigma. Transcriptor High Fidelity cDNA Synthesis Kit (Roche ...
-
bioRxiv - Immunology 2021Quote: ... qRT-PCR analysis was performed with PerfeCTa SYBR Green Fastmix (Quantabio) using the following primers from Sigma-Aldrich: S1pr1 (5’-AGCTTTTCCTTGGCTGGAGAG ...
-
bioRxiv - Cancer Biology 2022Quote: The integrated gRNAs were sequenced by the following primers using the Expand High Fidelity PCR system (Sigma-Aldrich): GeCKO 1717F 5′-GAGGGCCTATTTCCCATGAT-3′ and GeCKO 3913R 5′- CGGTGCCACTTTTTCAAGTT -3′ ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the pPB_EF1_MCS-EGFP_IRES_Puro as a PCR template and utilising primers with the respective knockin-overhangs (ordered from Sigma-Aldrich). Gel-extracted PCR products (Thermo Fisher Scientific ...