Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for Recombinant Human Programmed Cell Death 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and anti-mouse FITC tagged (1:200, Sigma) at room temperature in dark for 90 min ...
-
bioRxiv - Genetics 2019Quote: ... centrifuged 20 min at 20000 g and recombinant GST-tagged proteins were purified using the GST-BindTM Kit (Novagen). To synthetize the NOVA2 RNA target ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-His tag (HIS.H8, 1:1,000, Millipore). The HRP-conjugated anti-mouse (111–035-144 ...
-
bioRxiv - Biochemistry 2022Quote: ... and anti-His (1:3000) antibody (Sigma). HRP conjugated mouse IgG was used at 1:5000 dilution (Sigma ...
-
bioRxiv - Plant Biology 2021Quote: ... anti-His monoclonal antibody (Sigma, 1:1000) and anti-mouse (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... or anti-HIS (1:10,000, Sigma H1029) was used ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His (mouse, 1:3k, Sigma, A7058), anti-c-Myc (mouse ...
-
bioRxiv - Developmental Biology 2021Quote: ... The obtained antisera were affinity-purified with recombinant Emi2-His protein electroblotted onto a membrane (Immobilon; EMD Millipore).
-
bioRxiv - Zoology 2020Quote: ... recombinant RhATG5 and RhATG5191-199Δ were affinity-purified using Ni-NTA His•Bind Resin (Merck-Millipore, Darmstadt, Germany). Recombinant RhATG5 and RhATG5191-199Δ were then incubated with 10µg μ-calpain (Merck ...
-
bioRxiv - Cell Biology 2019Quote: ... Washed cells were treated with TRITC tagged Concanavalin A (20 µg ml-1) (Sigma, USA) for 1 h at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: Lentiviral particles encoding Flag-tagged human PDHA1 or shRNAs targeting mouse Pdha1 (TRCN0000041914/TRCN0000041914 (Sigma)) were produced in 293T packaging cells by transient transfection using Jet-PEI reagent (Ozyme) ...
-
bioRxiv - Biochemistry 2024Quote: ... PLA2G15 used in the reactions was obtained by overexpressing C-terminally FLAG-tagged human PLA2G15 in HEK293FT cells and affinity-isolation using anti-FLAG magnetic beads (Sigma-Aldrich #M8823).
-
bioRxiv - Microbiology 2022Quote: ... difficile spores were incubated with 10 µg mL−1 of recombinant human purified E-cadherin (5085, Sigma-Aldrich, USA) with PBS for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... pLysS cells expressing His-topoIB and T18 tagged genome segregation proteins in different combinations using the kit Protein G immunoprecipitation from Sigma-Aldrich as described previously (Maurya et ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 ug inactive MEK1 (C-terminally His-tagged) in a total volume of 40 μL buffer (20 mM Hepes pH 8 (MERCK, Sigma Aldrich, catalogue No ...
-
bioRxiv - Cell Biology 2023Quote: ... East Brunswick, NJ, USA), human recombinant Stem Cell Factor (100ng/mL, supernatant SCF producing cell line) and dexamethasone (1μM; Sigma, St. Louis, MO, USA).5 EBL cultures were kept at a density of 0.7-1.5 million/mL by dilution with fresh medium ...
-
bioRxiv - Neuroscience 2023Quote: ... TUNEL-positive cells were stained using the in-situ cell death detection kit TMR red (11684795910; Sigma-Aldrich) following the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2021Quote: Recombinant human fibroblast activation protein alpha (FAP) expressed in Sf21 cells (400-600 ng/μL) was purchased from Sigma-Aldrich and used at the final concentrations indicated for each experiment ...
-
bioRxiv - Cancer Biology 2022Quote: ... PDAC cells were treated with human recombinant FasL (MiaPaCa2: 50 ng/mL; TKCC10: 100 ng/mL) (Sigma-Aldrich, cat. SRP3036), 48 hours post transfection ...
-
bioRxiv - Cell Biology 2021Quote: For conjugation of SNAP-tagged proteins (paxillin, kindlin) recombinant proteins to be labeled with fluorophores were concentrated using Amicon Ultra Centrifugal Filter units (Millipore) to ∼50 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... GST-tagged recombinant protein was eluted by three sequential incubations of GSH-beads with 50mM reduced L-GSH (SIGMA, G4251) in 100mM Tris-HCl [pH8.0],150mM NaCl ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant proteases were obtained from the following vendors: human cathepsin L (Millipore Sigma, Athens Research and Technology ...
-
bioRxiv - Cell Biology 2020Quote: ... 100 ng/ml cholera toxin and 10 μg/ml recombinant human insulin (Sigma). MCF10A I-PpoI cells and MCF10A AsiSI cells were previously described (Harding et al. ...
-
bioRxiv - Genomics 2022Quote: ... supplemented with 0.5 mg/mL recombinant human albumin (Sigma-Aldrich, St. Louis, MO), 213 μg/mL L-ascorbic acid 2-phosphate (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... and 200 nM of recombinant human purified E-cadherin (5085, Sigma-Aldrich, USA) for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... After 16 h 50 ng/ml of recombinant human (rh)TGFA (Sigma-Aldrich) and/or Afatinib (5 µM ...
-
bioRxiv - Neuroscience 2023Quote: ... and human recombinant FGF-2 (10 ng/ml; Merck Millipore, Burlington, MA, USA) as mitogens ...
-
bioRxiv - Developmental Biology 2022Quote: ... 50 μL of sample or standard (Recombinant human IFN-α, IFNA: Millipore, IF007) were added ...
-
bioRxiv - Immunology 2022Quote: ... were coated with 100 ng per well recombinant human ACE2 (hACE2) (Sigma-Aldrich) in PBS ...
-
bioRxiv - Genetics 2022Quote: ... the beads were incubated in 10 μg/ml recombinant E-cadherin (human, Sigma) solution overnight at 4 °C with agitation ...
-
bioRxiv - Biophysics 2023Quote: BCL-2 active humans (recombinant, expressed in E. coli) were purchased from Sigma. Navitoclax ...
-
bioRxiv - Bioengineering 2023Quote: Insulin-azide and insulin-alkyne were prepared from recombinant human insulin (EMD Millipore) by selective acylation of the B29Lys residue as previously reported.33 ...
-
bioRxiv - Cancer Biology 2021Quote: ... inhibition of growth and death were assayed by staining cells with trypan blue (Sigma-Aldrich) followed by cell counting using Vi-cell XR Cell Viability Analyzer (Beckman Coulter).
-
bioRxiv - Cell Biology 2022Quote: ... TUNEL staining was performed using In Situ Cell Death Detection Fluorecein kit (Sigma cat# 11684795910) prior to addition of anti-recoverin primary antibody ...
-
bioRxiv - Plant Biology 2019Quote: ... The recombinant proteins with either FLAG-tag or His-tag were purified by corresponding immune affinity agarose beads (Sigma).
-
bioRxiv - Cell Biology 2022Quote: ... HCP-1 was produced similarly but in Hi-5 cells maintained in EX-Cell 405 medium (Sigma-Aldrich) and collected after 66h infection ...
-
bioRxiv - Bioengineering 2020Quote: Human monocytic THP-1 cells (Sigma Aldrich, lot# 16K052) were cultured and expanded in suspension at a cell density of (0.5–1.5)·106 cells·ml−1 culture medium (RPMI-1640 containing 10 % FBS and 1 % P/S ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-SATB2 (human cells, 1:200; HPA029543, Sigma Aldrich) and Anti-Beta Actin (1ug/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... and Mirg-/-littermates injected subcutaneously with Growth factor-reduced Matrigel BD) with 400 ng mL-1 recombinant human bFGF (Millipore). After 7 days Matrigel plugs ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then stained with 1 µg/mL His-EqtII-EGFP and DAPI (D9542, SIGMA) at room temperature for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... Non-specific binding sites were blocked using fluorescence-activated cell sorting (FACS) buffer (1× PBS, 2% hi-FBS) supplemented with 20% hi-FBS and 10 μg mouse IgG (Sigma-Aldrich, St-Louis, MO, USA). Cells were stained using the following conjugated mouse anti-human monoclonal antibodies (mAbs) ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse anti-His antibody (1:12000) (Sigma-Aldrich) and biotinylated PNA (1:6000 ...
-
bioRxiv - Cell Biology 2021Quote: ... and Anti-His(1:3000) antibody(Sigma #H1029).HRP conjugated mouse IgG was used at 1:4000 dilution(Sigma #A3673 ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-His (Sigma H1029; 1:3000 for IB), anti-Hsp70 (Abcam ab47455 ...
-
bioRxiv - Biochemistry 2024Quote: ... An anti-His-primary antibody (Sigma, 1:2,000) was incubated with the protein-treated lipid strips to detect Jps1 bound via its C-terminal His-tag ...
-
bioRxiv - Cell Biology 2023Quote: Lentivirus containing a plasmid programmed to express either CMIP-specific sgRNA (ACGTCTTCAATGGCGCTGTAGG, Millipore Sigma, Sanger Clone MM5000005403) or non-targeting control sgRNA (Millipore Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... respectively (Millipore Cat# HI-14K, HI-13K). Samples treated with 3 mM glucose KRBH were measured undiluted ...
-
bioRxiv - Genomics 2020Quote: ... RPMI-1640 medium used to culture the MCF7 cells was additionally supplemented with 0.01 mg/ml human recombinant insulin (Sigma Aldrich, #I3536).
-
bioRxiv - Immunology 2023Quote: ... The pull-downed proteins were separated by SDS-PAGE on 10-to-20% gradient gel (ATTO) and the recombinant FLAG- tagged WT sCTLA-4 was detected by anti-FLAG M2 antibody (Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2021Quote: TUNEL analysis was performed using the In Situ Cell Death Detection Kit (Kit #11684795910, Sigma Aldrich) following manufacturer’s recommendations and fluorescein-dUTP ...