Labshake search
Citations for Millipore Sigma :
101 - 150 of 976 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... reverse transcribed with AMV RT (Sigma 10109118001), and then cDNA were quantified in multiplex TaqMan qPCR reactions using commercially available probe sets (Thermo Fisher 4453320 ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 1U ThermaStop-RT (Sigma-Aldrich) per 50U SSIII to increases RT-PCR specificity ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 minutes at RT and permeabilized for 15 minutes at RT with 0.2% Triton 100 X buffer (Sigma). Calu-3 cells were fixed with 4% PFA for 20 minutes at RT and permeabilized for 15 minutes at RT with 0.2% Triton 100X buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Cyber Green master mix (Sigma Aldrich) was used for both qPCR and nl-qPCR however there was 1.8-fold more DNA in nl-qPCR reactions ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR primers were purchased from Sigma-Aldrich, KiCqStart Primers ...
-
bioRxiv - Immunology 2022Quote: ... qPCR primers were purchased from Sigma-Aldrich. A complete list of primer sequences is provided in Supplementary Table 1.
-
bioRxiv - Genetics 2019Quote: ... Primers for SYBR green qPCR (Sigma-Aldrich) were designed using Primer-BLAST (NCBI ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed with primer pairs (Sigma) listed in Table S1 ...
-
bioRxiv - Physiology 2023Quote: ... KiCqStart SYBR Green qPCR ReadyMix (Sigma Aldrich), along with 300 nM forward and reverse primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sections were washed two times with PBS and incubated for two hours at RT with corresponding secondary antibodies and subsequently incubated for 30 min at RT with DAPI (Sigma). Stained sections were washed two times with PBS and mounted with either Fluorsave (Chemicon ...
-
bioRxiv - Cancer Biology 2021Quote: Gene expression was measured by quantitative RT-PCR and normalized to β-actin8,48 The SYBR Green quantitative RT-PCR kit (Sigma) was used with the following primers ...
-
bioRxiv - Microbiology 2020Quote: ... RT SigmaFast O-phenylenediamine (OPD) substrate (P9187, Sigma) was added to the wells after six additional washes to develop the colorimetric reaction ...
-
Anatomical meniscus construct with zone specific biochemical composition and structural organizationbioRxiv - Bioengineering 2019Quote: ... SybrGreen Quantitative RT-PCR kit (Sigma Aldrich, Germany) was used with Corbett Rotor-Gene 6000 (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... permeabilized at RT with 0.25% TritonX100 (Sigma #T9284) for 10 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... and 50 mg Fast Blue RT (Sigma-Aldrich) in 100 ml of 50 mM 2-amino-2-methyl-1,3-propanediol buffer (pH 9.8) ...
-
bioRxiv - Cancer Biology 2020Quote: Reverse transcription (RT) reactions were carried out using 1 µg of RNA using Transcriptor RT enzyme (Catalog No. 03531287001) from Sigma Aldrich. IR minigene PCRs were performed as previously reported ...
-
bioRxiv - Microbiology 2020Quote: ... Novagen Bugbuster Master Mix (Novagen, Merck, USA) and three additives (NaOH ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in BugBuster Master Mix (EMD Millipore) (volume ...
-
bioRxiv - Systems Biology 2023Quote: ... 70 µl BugBuster master mix (EMD Millipore) was added to each sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were blocked at RT with 5% BSA (Sigma) dissolved into PBS ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 µL ThermaSTOP RT (Sigma Aldrich, #TSTOPRT-250). Mix 1 was heated to 65°C for 5 min and then snap-chilled on ice for at least 2 min ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and Hoechst 33342 (1μg/mL; 5 min; RT; Sigma).
-
bioRxiv - Molecular Biology 2022Quote: RNA was isolated by using RNAZol-RT reagent (Sigma) from exponentially growing MtbH37Rv/Msm mc2155 and its Rho CKD strain ...
-
bioRxiv - Developmental Biology 2023Quote: ... overnight at RT and included in paraffin (Sigma-Aldrich) following standard procedures ...
-
bioRxiv - Cell Biology 2023Quote: ... at RT and fixed with 4% paraformaldehyde (Sigma Aldrich) in CB for 20 min (RT) ...
-
Highly efficient homology-directed repair using transient CRISPR/Cpf1-geminiviral replicon in tomatobioRxiv - Molecular Biology 2019Quote: ... DNA amplicons and related donor template levels were evaluated by semiquantitative PCR and qPCR (using KAPA SYBR FAST qPCR Kits, Sigma-Aldrich, USA), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... The list of qPCR primers (from Sigma-Aldrich, USA) is shown in Table 2 in Supplementary Material.
-
bioRxiv - Neuroscience 2022Quote: ... qPCR was performed using primers specific for actin (Sigma) and SRY (Thermofisher) ...
-
bioRxiv - Immunology 2020Quote: ... and predesigned KiCqStart® qPCR Ready Mix (Sigma-Aldrich) or TaqMan gene expression assays (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2019Quote: The qPCR primers were synthesized by Sigma-Aldrich (USA) and the list of primers used in this study is provided in Supplementary Tables 1 and 2.
-
bioRxiv - Microbiology 2021Quote: ... and LuminoCT Taqman Master Mix (#L6669; Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and KOD Hot Start Master Mix (Millipore Sigma). Amplicons from clone #8 were sent to Massachusetts General Hospital Center for Computational and Integrative Biology DNA Core for Complete Amplicon Sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... lysed in 300 µL Bugbuster Master Mix (Millipore), and clarified before analyzing supernatants by absorption and fluorescence spectroscopy in a Tecan 20M plate reader ...
-
bioRxiv - Microbiology 2019Quote: ... with the universal primers NL1 (GCATCAATAAGCGGGAGGAAAG) and NL4 (GGTCCGTGTTTCAAGGGG. A master mix solution was prepared containing 25 µl of KOD (Hot start Master Mix-Sigma Aldrich), 1.5 µl of each primer and 18.5 µl of NFW ...
-
bioRxiv - Microbiology 2021Quote: ... and stained for 5 minutes at RT with Giemsa (Sigma) diluted 1:1 in deionized water ...
-
bioRxiv - Microbiology 2021Quote: ... and stained for 5 minutes at RT with Giemsa (Sigma) diluted 1:1 in deionized water ...
-
bioRxiv - Pathology 2022Quote: ... permeabilized (0.1% Triton X-100, Sigma, in PBS, 20min., RT), blocked with 2% goat serum (Life technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative RT-PCR was performed using Kapa SYBR Fast (Sigma). SREBP genes primer sequences are listed in Supplementary Table S3 ...
-
bioRxiv - Molecular Biology 2020Quote: RT-PCR: 106 cells were lysed in TRI reagent (Sigma) and RNA extracted using Direct-zol columns with a 30 minute on-column DNase step at room temperature (Zymo Research) ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted using RNAzol®RT (Sigma-Aldrich) and 2 µg of total RNA was subjected to reverse transcription using qScript cDNA Synthesis Kit (Quanta) ...
-
bioRxiv - Cell Biology 2020Quote: ... the TRAPEZE® RT Telomerase Detection Kit (Chemicon; EMD Millipore) was utilized ...
-
bioRxiv - Cell Biology 2022Quote: ... RT and alkylated using 5.5 mM of iodoacetamide (Sigma-Aldrich) for 45 min ...
-
bioRxiv - Immunology 2022Quote: ... fixed cells were blocked at RT with 1% BSA (Sigma) in PBS for 30 min and permeabilized with 0.1% Triton-X100 (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... were incubated for 1h at RT and DAPI (Sigma-Aldrich) was added for 10min to counterstain nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... for 20 min at RT and 70% isopropanol (Sigma-Aldrich) was added for 5 min ...
-
bioRxiv - Genetics 2023Quote: ... and 1 volume of chloroform (2 min, RT, Sigma Aldrich), the aqueous phase was recovered after centrifugation at 12 000 g ...
-
bioRxiv - Microbiology 2023Quote: ... viral RNA was isolated using RNAzol®RT (Sigma- Aldrich) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... for 30 min at RT followed by 1 h incubation at RT with rabbit anti-FLAG antibody (1:500, Sigma-Aldrich, St. Louis, MO, USA) and mouse anti-SEC31A antibody (1:500 ...
-
bioRxiv - Microbiology 2019Quote: ... the KAPA SYBR FAST Universal qPCR kit (Sigma-Aldrich, Sweden), and primers specific to the conserved gtfB and gtfC regions in a Corbett Rotor-Gene 6000 apparatus [29] (S1 Table) ...
-
bioRxiv - Immunology 2022Quote: ... All oligonucleotides for qPCR were either purchased from Sigma-Aldrich or produced at the Yale University Keck Oligonucleotide Synthesis Facility (see sequences in Table S1).