Labshake search
Citations for Millipore Sigma :
1 - 50 of 976 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... RT-qPCR was performed using KAPA SYBR® FAST qPCR Master Mix (2X) Universal (Sigma-Aldrich) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... RT-qPCR was performed using FastStart Universal SYBR Green Master (Sigma-Aldrich) and primers are given in Supplementary Table 9.
-
bioRxiv - Systems Biology 2020Quote: RT-qPCR was carried out using FastStart Universal SYBR Green Master Mix (Rox) (Sigma Aldrich) in an Applied Biosystems QuantStudio 6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Stimulation master mixes were made by adding CaCl2 (1M stock in H2O, Sigma), Ionomycin (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by RT-qPCR with the FastStart Universal SYBR Green Master (Sigma-Aldrich, Cat No. 4913850001). Primers are listed in Supplementary Table 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR analysis was performed using the KAPA SYBR Fast PCR master mix (Sigma Aldrich, #KK4605) or SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Physiology 2021Quote: ... For the RT-qPCR the Kappa Mix (Sigma) was used and the primers concentration was 10 µM ...
-
bioRxiv - Genomics 2021Quote: ... qPCR was performed using KAPA SYBR® FAST qPCR Master Mix (Sigma Aldrich) and run on the C1000 Touch™ thermal cycler (BIO-RAD ...
-
bioRxiv - Developmental Biology 2021Quote: ... RT-qPCR was performed using SYBR Green Mastermix (Sigma) and primers detailed in Table 3.
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was performed with SYBR Green Quantitative RT-qPCR Kit (Sigma-Aldrich; Cat. No. QR0100) using GAPDH as a housekeeping gene ...
-
bioRxiv - Plant Biology 2019Quote: Q-PCR was performed on a Roche Lightcycler using standard reverse transcriptase kit and SYBR Green Real-Time PCR Master Mixes (SIGMA).
-
bioRxiv - Biochemistry 2022Quote: ... and FastStart Universal SYBR Green QPCR Master (Rox) (Sigma) using Roche LightCycler 480 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and FastStart Universal SYBR Green QPCR Master (Rox) (Sigma) using Roche LightCycler 480 ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Kicqstart One-Step Probe RT-qPCR ReadyMix (KCQS07; Sigma). Gli1 (Wen et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... phosphatase inhibitor mixes (Sigma, P5726 and P0044) and protease inhibitor mix (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... KAPA SYBR® Fast qPCR Master Mix (2x) Kit (Sigma), was used ...
-
bioRxiv - Immunology 2024Quote: ... KAPA SYBR FAST qPCR Master Mix (2X) (Millipore Sigma; KK4600) and a QuantStudio 7 Pro qPCR (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR primers were ordered as dried pellets from Sigma-Aldrich. The oligonucleotides were dissolved in 1X TE pH 8.0 to a final concentration of 100 μM and stored at 4 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCR reactions were performed using SYBR Green Master Mix (Sigma L6544) and primers for pyruvate carboxylase (Forward ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA oligonucleotides (RT-qPCR primers) were obtained from Sigma-Aldrich (Rehovot, Israel). Mouse monoclonal antibodies against ARC (sc-17839 ...
-
bioRxiv - Microbiology 2024Quote: ... with commercial RT-qPCR primers (KiCqStart SYBR Green Primers, Millipore Sigma KSPQ12012) and was assayed in Applied Biosystems QuantStudio 3 Real Time PCR System with standard cycling conditions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... GLC-20 and GLC-30 FAME standard mixes (Sigma) were tested using this protocol to ensure proper capture of all chain lengths and to gauge retention times ...
-
A transient but very intense mutational burst occurs during the normal development of yeast coloniesbioRxiv - Genetics 2023Quote: ... These mixes were either the “drop-out’’ (Sigma-Aldrich) or “CSM” (MP Biotech) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... GLC-20 and GLC-30 FAME standard mixes (Sigma) were tested using this protocol to ensure proper capture of all chain lengths and to gauge retention times ...
-
bioRxiv - Genetics 2022Quote: ... and KAPA SYBR FAST qPCR Master Mix (2X) Kit (Sigma-Aldrich, USA). RT-qPCR primers for the FLO1 gene were 5′-CGCCGATCACATCAACGAACT-3′ and 5′-ACCCCATGGCTTGATACCGTC-3′ ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were amplified using FastStart Universal SYBR Green QPCR Master (Rox) (Sigma), DNA-specific primer pair ...
-
bioRxiv - Systems Biology 2022Quote: ... qPCR assays were performed using FastStart Universal SYBR Green Master mix (Sigma) according to the manufacturer’s protocol with minor modifications ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-qPCR was performed using SYBR-Green Mastermix with ROX reference dye (Sigma). A list of all primer sequences used can be found in Table 1 below ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were diluted 1:2 for RT-qPCR using SYBR Green Mastermix (Sigma) and primers detailed in Table 3.
-
bioRxiv - Developmental Biology 2021Quote: ... qRT-PCR was performed with SYBR Green Quantitative RT-qPCR Kit (QR0100; Sigma) or Kicqstart One-Step Probe RT-qPCR ReadyMix (KCQS07 ...
-
bioRxiv - Microbiology 2021Quote: ... A PCR master mix was prepared using 10 µL KAPA SYBR FAST qPCR Master Mix (2X) (Sigma-Aldrich, Gillingham, UK), 0.4 µL ROX High ...
-
bioRxiv - Bioengineering 2022Quote: ... Real-Time qPCR was performed using the Fast SYBR Green Master Mix (Sigma) in a QuantStudio 5 Real-Time-PCR-Cycler (Thermofisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... using the KAPA SYBR® FAST qPCR Master Mix (2×) Kit (Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... qRT-PCR was performed with Kicqstart One-Step Probe RT-qPCR ReadyMix (KCQS07; Sigma). Inventoried TaqMan probes for qRT-PCR from Applied Biosystems were used for human TULP3 and GAPDH ...
-
Cold exposure drives weight gain and adiposity following chronic suppression of brown adipose tissuebioRxiv - Physiology 2021Quote: ... RT-qPCR was carried out as previously described using rat-specific oligonucleotide primers (Sigma) or FAM-MGB Taqman probes [42] ...
-
bioRxiv - Developmental Biology 2022Quote: RT-qPCR was performed with the SYBR Green JumpStart Taq Ready Mix (Sigma – S4438) and custom-made primers (Supplementary Table 4) ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR was performed using FastStart Universal SYBR Green Master (Rox) (Sigma, 4913850001) on a Bio-Rad CFX Connect Real-Time PCR detection system ...
-
bioRxiv - Cell Biology 2022Quote: ... Mixes of PAA and bis-acrylamide (N,N′-methylenebisacrylamide, Sigma-Aldrich) corresponding to elasticity of 1 kPa and 40 kPa were prepared as described (Tse and Engler ...
-
bioRxiv - Neuroscience 2022Quote: ... This was followed by SYBR® Green RT-qPCR reaction using KiCqStart™ SYBR® Green qPCR ReadyMix™ (Millipore Sigma, Cat # KCQS00). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... qPCR was performed using the KAPA SYBR FASTqPCR kit Master Mix (Sigma-Aldrich, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... to generate cDNA and performed qPCR using FastStart Universal SYBR Green Master (Sigma Aldrich). We used primers against Citrine (CGGCGACGTAAACGGCCACAAGTTCAG ...
-
bioRxiv - Genomics 2021Quote: ... Reactions per sample were pooled and library concentration was quantified via qPCR using the KAPA SYBR FAST qPCR Master Mix (Sigma-Aldrich, KK4602). UMI-4C libraries were pooled and sequenced on an Illumina HiSeq or NovaSeq (paired-end ...
-
bioRxiv - Physiology 2019Quote: ... RT-qPCR was carried out as previously described [20] using rat-specific oligonucleotide primers (Sigma) or FAM-MGB Taqman probes (see Supp Table 1 for primer list) ...
-
bioRxiv - Microbiology 2019Quote: ... A standard curve using these assay mixes and para-nitrophenyl (pNP) (Sigma) was created ...
-
bioRxiv - Molecular Biology 2023Quote: ... using 10 μl of KAPA SYBR FAST qPCR Master Mix (2X) ABI Prism (Sigma-Aldrich), which contains a Taq DNA polymerase that lacks proofreading activity ...
-
bioRxiv - Physiology 2023Quote: ... AAV genome copy numbers were quantified with qPCR using FastStart Probe master mix (Sigma, Germany) on a CFX96 thermal cycler (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Ms1 and the m7G-capped control were quantified by RT-qPCR with SYBR Green (Sigma). The fraction of treatment-resistant Ms1 was calculated by dividing the amount of transcripts left after the enzymatic treatment (resistant ...
-
bioRxiv - Cell Biology 2020Quote: ... These mixes were aliquoted in smaller volumes (60μl) and different cryoprotectants (DMSO (Sigma), DMF (Carl Roth) ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR reaction mixture consisted of Kappa Probe Fast qPCR Master Mix (2X) Kit (Sigma-Aldrich), 0.75 μL of primers and 2.5 μL of RNA in a final volume of 10 μL reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR reactions were performed in triplicate using SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma). Primers used were ...