Labshake search
Citations for Millipore Sigma :
51 - 100 of 10000+ citations for Human Single stranded DNA binding protein 4 SSBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... double stranded DNA (dsDNA) (Sigma, D4522), single stranded DNA (ssDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA binding proteins including target RNAPs were precipitated by addition of polyethyleneimine (PEI, Sigma-Aldrich) to 0.6% (w/v ...
-
bioRxiv - Molecular Biology 2019Quote: ... The DNA-binding domain of human Timeless (DBD; residues 816-954) was cloned into pRSF-Duet1 (Novagen) with an N-terminal His14-SUMO tag and expressed in E ...
-
bioRxiv - Neuroscience 2020Quote: ... and retinal levels of human Pi and serum levels of human insulin were measured using human Pi and human insulin ELISA kits (EZHPI-15K and EZHI-14K, respectively; Millipore, Darmstadt, Germany) according to the manufacturer’s instructions and as described previously (Isiegas et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... and (GT)15 single-stranded DNA (10 g/L, Integrated DNA Technologies, Coralvile, IA, USA) suspended in 1X PBS (phosphate-buffered saline, Sigma-Aldrich, St. Louis, MO, USA) were added to a final oligonucleotide:SWCNT mass ratio of 2:1 ...
-
bioRxiv - Cell Biology 2019Quote: Guide RNA (gRNA) sequences were synthesised as single stranded oligos (Sigma-Aldrich), annealed and cloned in the vectors PX458 (pSpCas9(BB)-2A-GFP ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... DNA was immobilized on nitrocellulose and analyzed by immunodot blotting with antibodies against cyclobutane pyrimidine dimers (CPDs; Cosmo Bio NM-DND-001) and single-stranded DNA (Millipore MAB3034).
-
bioRxiv - Cell Biology 2022Quote: ... The cDNA encoding mouse BANF1/BAF was synthesized using two120-mers and a 90-mer single-stranded DNA oligonucleotides (Table 2, Sigma-Aldrich). These ssDNA oligonucleotides each contain a 15-mer overlapping sequence at both ends ...
-
bioRxiv - Genetics 2019Quote: ... probes were precipitated by adjusting the solution to 70% ethanol in presence of 20 μg single stranded sheared salmon sperm DNA (Sigma-Aldrich), followed by centrifugation at 14,100 G ...
-
bioRxiv - Bioengineering 2022Quote: ... Recombinant human IL6 protein had been diluted in assay diluent (PBS with 5 mM EDTA, 100 μg/ml single-stranded salmon sperm DNA (Sigma Aldrich), 0.1% BSA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking with 5% BSA in PBS for 1 hour at 37°C and incubation with an anti single-stranded DNA antibody (Sigma, MAB3034) diluted 1:80 in 5% BSA in PBS ...
-
bioRxiv - Bioengineering 2023Quote: ... HA (HA binding protein, #385911, Sigma Aldrich), αSMA (#19245S ...
-
bioRxiv - Cancer Biology 2020Quote: RIP assays employed the Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore Sigma) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RIP assay was done with Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, USA). Quantitative RT-PCR was used for determining total RNA levels.
-
bioRxiv - Biophysics 2020Quote: The single-stranded oligonucleotide sequence CCAATTGG and resveratrol were purchased from Sigma Aldrich Co. ...
-
bioRxiv - Cell Biology 2020Quote: ... The reaction was initiated by the addition of 6 μM vitamin D binding protein [DBP] (Human DBP, G8764, Sigma) directly in the fluorometric cuvettes ...
-
bioRxiv - Physiology 2021Quote: Plasma FGF21 (pg/ml) was measured using a human FGF21 ELISA kit (Millipore, Billerica, MA). In Experiment 2 ...
-
Preferred endocytosis of amyloid precursor protein from cholesterol-enriched lipid raft microdomainsbioRxiv - Neuroscience 2020Quote: ... Aβ42 levels were measured using a High Sensitivity Human Amyloid β42 ELISA Kit (Millipore, #EZHS42).
-
bioRxiv - Cancer Biology 2020Quote: ... Biotinylated hyaluronan-binding protein (HABP) wassupplied by Millipore-Sigma ...
-
bioRxiv - Biochemistry 2020Quote: ... Biotinylated hyaluronic acid binding protein (Sigma-Aldrich, Singapore) were diluted in blocking buffer and incubated with samples overnight at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... Hyaluronic Acid Binding Protein (HABP; Millipore-Sigma, 385911), Ki67 (1:50 dilution ...
-
bioRxiv - Bioengineering 2022Quote: ... Hyaluronic Acid Binding Protein (HABP; Millipore-Sigma, 385911), Ki67 (1:50 dilution ...
-
bioRxiv - Cell Biology 2021Quote: RIP assays were performed using the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, USA) with the mouse anti-Ago2 antibody (Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: RIP was performed according to the Magna-RIPTM RNA-binding protein immunoprecipitation kit (Millipore/Merck) as previously described (Papoutsoglou et al ...
-
bioRxiv - Molecular Biology 2022Quote: RNA immunoprecipitation was performed using the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, Billerica) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: RIP experiment was optimized using the Magna RIP RNA-binding protein immunoprecipitation kit (Millipore, USA) in light of the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and RIP assays were carried out with Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore) and anti-Flag antibody (Abcam ...
-
bioRxiv - Molecular Biology 2021Quote: ... media was collected and used to measure secreted Cxcl1 protein on an ELISA plate according to the KC/Cxcl1 ELISA kit manufacturer’s instructions (Sigma-Aldrich #RAB0117). Absorbance values at 450 nm were measured with a Tecan plate reader ...
-
bioRxiv - Pathology 2023Quote: ... Human IgG ELISA assay (RAB0001, Sigma, Saint Louis, MO) was performed per manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... single strand DNA (Sigma-Aldrich, D8899) were coated onto 96-well half-area high- binding ELISA plates (Corning ...
-
bioRxiv - Bioengineering 2021Quote: ... single strand DNA (Sigma-Aldrich, D8899) were coated onto 96-well half-area high-binding ELISA plates (Corning ...
-
bioRxiv - Microbiology 2020Quote: The fluorescent DNA-binding stain DAPI (Sigma Aldrich) was used to visualise cell distribution as described previously (63) ...
-
bioRxiv - Neuroscience 2022Quote: RNA immunoprecipitation was performed using the Magna RIP® RNA-Binding Protein Immunoprecipitation Kit (Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: RNA-binding protein immunoprecipitation was run according to supplier recommendations (Millipore, Magna RIP Kit, 17-700). Beads were conjugated with 10 μg either anti-IMP3 (#1 ...
-
bioRxiv - Molecular Biology 2019Quote: RIP experiments were performed using a Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: RNA immunoprecipitation was performed using the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (17-700; Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: RNA-binding protein immunoprecipitation (RIP) was performed using a Magna RIP kit (Cat# 17-700, Millipore) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... we performed a RIP assay using Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, Burlington, MA). HDFa were lysed in RIP lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: RIP assays were performed using the Magna RIPTM RNA-binding protein immunoprecipitation kit (Millipore, Massachusetts, USA). Cells in 15 cm dishes were lysed in complete RIP lysis buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Biotinylated hyaluronan-binding protein (HABP) was supplied by Millipore-Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... filtered through a 0.45μm low protein-binding filter (Millipore), and used to transduce Vero cells ...
-
bioRxiv - Cell Biology 2021Quote: Biotinylated hyaluronan-binding protein (HABP) was supplied by Millipore-Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... using biotynilated HA-binding protein (385911, Sigma Aldrich, USA) and biotynilated GSLII (B-1215 ...
-
bioRxiv - Immunology 2023Quote: ... filtered through 0.45 μm low- protein-binding filters (Millipore) and concentrated via 16 hours centrifugation at 3000 x g at 10 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’) was synthesized by Sigma Aldrich. The gRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Albumin was measured in the cell culture medium by Human ALB/Serum albumin ELISA Kit (Sigma-Aldrich) and in the cell lysate by qPCR ...
-
bioRxiv - Immunology 2022Quote: Concentrations of human serum albumin in human plasma and bronchoalveloar lavage fluid were measured using an ELISA kit from Sigma Aldrich (Cat. #RAB0603) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: The protein mixtures were filtered using a low protein binding filter (Millipore Sigma) and purified on a SourceQ15 anion exchange column (Cytiva ...
-
bioRxiv - Cancer Biology 2022Quote: ... genomic DNA was amplified with the GenomePlex Single Cell Whole Genome Amplification Kit (Sigma). Amplified DNA was purified ...
-
bioRxiv - Immunology 2020Quote: Commercial antigens were double stranded DNA (cat. D3664, SIGMA), insulin (I9278 ...