Labshake search
Citations for Millipore Sigma :
601 - 650 of 886 citations for Ebola Virus Like Particles since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... The supernatant containing pseudo-virus was centrifuged at 3000g and filtered through a 0.45μm sterilized membrane (Millipore, Burlington, MA). The titer of virus generated by engineered Zhou-COVID-19-Spike plasmid is ten-fold higher than non-engineered Spike protein sequence (data not shown) ...
-
bioRxiv - Microbiology 2021Quote: ... cell monolayers were washed twice with PBS before adding virus inoculum in DMEM supplemented with 1μg/ml of trypsin TPCK (Sigma) and no FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... HUVECs were transduced with optimal volume of lentiviral virus at 50% confluence in MV2 medium and 8μg/ml Polybrene (Sigma). After 24 h ...
-
bioRxiv - Biochemistry 2022Quote: The virus was precipitated from the cell supernatant by adding 8 % (w/v) polyethylene glycol (PEG) 8000 (Sigma-Aldrich), incubating at +4 °C with gentle mixing for 3 h ...
-
bioRxiv - Systems Biology 2023Quote: ... HEK293 cells were then transduced overnight with the filtered virus in the presence of 8 µg/mL polybrene (Millipore); the amount of virus used was optimized to ensure the infection rate of ∼20% ...
-
bioRxiv - Immunology 2023Quote: ... Next the pseudotyped virus-containing culture medium was diluted 50% in culture medium supplemented with 8μgml−1 polybrene (Sigma) and immediately applied onto MutuDC1 cells ...
-
bioRxiv - Microbiology 2023Quote: ... Virus supernatant was removed 6 hours post transduction and cells were maintained for 48 hours before puromycin (Sigma-Aldrich) selection ...
-
bioRxiv - Microbiology 2023Quote: ... Confluent MDCK cells were incubated with each serial dilution for 1h at 37°C then input virus was removed by aspiration and cells overlaid with SFM containing 0.14% BSA (Sigma), 0.8% Avicel© (FMC BioPolymer ...
-
bioRxiv - Biochemistry 2023Quote: ... Virus-containing supernatants were harvested after 48 h transfection and filtered by syringe through a 0.45 μM filter (Millipore) to eliminate cell contaminates ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were transduced with the virus for 48 h in the presence of 4 µg/ml polybrene (Sigma H9268).
-
bioRxiv - Microbiology 2023Quote: ... neutralized whole-virus samples were incubated in D2O buffer (99% deuterium oxide, Sigma 151882, supplemented with 120 mM NaCl). 40 μL D2O buffer was added to every 10 μL of neutralized virus (final D2O concentration 78% ...
-
bioRxiv - Cancer Biology 2023Quote: ... subconfluent cultures were incubated with virus-containing supernatants in the presence of 4µg/ml polybrene (Sigma-Aldrich , TR-1003) for 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... virus-containing supernatants were used to transduce A2EN cells in the presence of 8 µg/ml polybrene (Sigma-Aldrich). Cells were co-transduced with lentiviral vectors encoding the two distinct sgRNAs that target the same gene ...
-
bioRxiv - Microbiology 2023Quote: ... The medium for the culture of influenza A virus in MDCK cells (virus medium) was prepared by supplementing Minimal Essential Medium with 4.3% bovine serum albumin (BSA; Sigma) and Normocin.
-
bioRxiv - Microbiology 2024Quote: ... HA tagged proteins were detected in virus lysates using rabbit polyclonal anti-HA antibody (Cat# H6908, Sigma, 1:1,000). The V5 tagged proteins were detected in cell and virus lysates using anti-V5 mouse monoclonal antibody (Cat# V8012 ...
-
bioRxiv - Genetics 2023Quote: ... RPE-1 cells were transduced with lentivirus at an MOI of 0.3-0.5 (usually between 50-100 µL of virus/well) and 10 µg/mL Polybrene (Sigma-Aldrich). After 48 hours ...
-
bioRxiv - Physiology 2024Quote: ... C2C12 mouse myoblasts were seeded 24h prior to infection and then transduced with virus-containing supernatant supplemented with 8μg/mL polybrene (Millipore) as shown previously40 ...
-
bioRxiv - Microbiology 2024Quote: All transductions were performed via spin inoculation at 1050 x g for 2 hr at 25°C with equal virus amounts determined by Gag p24 mass in medium containing 4µg/mL polybrene (Sigma). MDMs were inoculated with 10µg p24 mass equivalents of NL4-3 ΔGPE-GFP virus or 20µg p24 mass equivalents of 3xFLAG-89.6-Vpr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The supernatants containing viral particles were harvested at 48 and 60 h after transfection and filtered through 0.45 µm cellulose acetate filters (Millipore, USA). Afterwards ...
-
bioRxiv - Microbiology 2019Quote: Calcofluor staining was achieved by depositing a drop of purified pandoravirus particles in PAS medium onto a glass slide and immediately adding 50μL of calcofluor white (Ref.18909; Sigma-Aldrich) and 50 μL of 10% KOH prior to glass slide covering and confocal imaging ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Pseudotyped particles were concentrated from producer cell supernatants that were overlaid on a 10% OptiPrep cushion in PBS (Sigma–Aldrich) and centrifuged at 20,000g for 2h at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5×106 cells were mixed in a well of a 12-well plate with varying concentrations of supernatant containing viral particles and 8 μg/ml of polybrene (Sigma) which was then centrifuged at 2,000 rpm for 30 minutes at 30°C.
-
bioRxiv - Cell Biology 2022Quote: ... Monocytes were transduced with equal volumes of freshly harvested LifeAct-mCherry and SIV3 lentiviral particles in the presence of 8 μg/mL of protamine (Sigma). At 48 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... Any remaining contaminants and empty or incomplete viral particles were removed with a discontinuous iodixanol (OptiPrepTM) (Sigma-Aldrich, Cat# D1556) gradient ultracentrifugation using four layers of different iodixanol concentrations of 15 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human bronchial epithelial cells (16HBEo-) were transduced with VSV-G pseudo-typed lentiviral particles in the presence of 3 μg/ml polybrene (Millipore). Expression vectors encoding the spike protein cDNA were directly transfected into 16HBEo− with Lipofectamine P3000 according to manufacturer’s recommendations (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... media of the 293T/T17 cultures was replaced and following 18 hours of incubation media containing viral particles were harvested and filtered through a 0.45 µm Durapore PVDF Membrane (Millipore SE1M003M00). Viral transfections were carried out over 72 hours ID8 parental cells and transduced cells were selected by their resistance to 2 μg/mL puromycin (MP Biomedicals 0219453910) ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 µL injections of the clarified extracts were separated using a 150 x 2.1 mm ZIC-pHILIC column (5 µm particle size, EMD Millipore). The chromatographic gradient was run at a flow rate of 0.15 mL/min as follows ...
-
bioRxiv - Cancer Biology 2019Quote: ... Supernatant containing lentiviral particles was used to infect cancer cells in the presence of 8 μg/ml polybrene (Sigma-Aldrich) overnight ...
-
bioRxiv - Cancer Biology 2021Quote: MFSD1kd tumor cells were generated by MISSION lentiviral transduction particles expressing short hairpin RNA (shRNA) from pLKO.1 vector targeting the coding sequence of MFSD1 (Sigma, TRC clone ID TRCN0000338002 and TRCN0000337937 ...
-
bioRxiv - Microbiology 2020Quote: Active and pseudotyped SARS-CoV-2 particles were immobilized by adding 0.01% Poly-L-Lysine (PLL, Sigma Aldrich, MIS, USA) for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... Five microliters of each sample were injected on a Zic-pHILIC Column (150×2.1 mm, 5 micron particles, EMD Millipore). The mobile phases are (A ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were taken from the reactions and the soluble fractions were separated from the insoluble substrate particles using a 96-well filter plate (Millipore) operated with a vacuum manifold ...
-
bioRxiv - Cancer Biology 2020Quote: ... host cells were transduced with viral particles in 6-well dish along with polybrene (hexadimethrine bromide; 8μg/ml) (Sigma-Aldrich) to increase the transduction efficiency ...
-
bioRxiv - Bioengineering 2022Quote: Cy5-HA cryogels were synthesized with low- and high-DOS HA-Tz and incubated in 1mL of FITC-labeled 10µM diameter melamine resin micro particles (Sigma Aldrich) at 0.29mg/mL concentration on a rocker at room temperature overnight ...
-
bioRxiv - Immunology 2022Quote: ... Fractions corresponding to Coxsackievirus A21 particles were pooled and concentrated to 0.5mg/ml using Amicon Ultra centrifugal filter units with 100 kDa cutoff (Millipore Sigma).
-
bioRxiv - Neuroscience 2022Quote: ... Viral particles were collected at 72 hours by filtering spent medium through a 0.45 μm cellulose acetate filter (Millipore Sigma), then concentrating the supernatant with AAVpro® concentrator (TaKaRa).
-
bioRxiv - Cell Biology 2022Quote: ... 400×105 JK6L-Cas9 cells were transduced with 30 μl of 10x concentrated lentiviral particles in the presence of 0.8 μm/ml polybrene (TR-1003; Sigma-Aldrich) and a final volume of 200 μl of complete DMEM ...
-
bioRxiv - Bioengineering 2022Quote: ... Lentiviral particles were harvested after 48-72 hours and used to transduce HEK293T cells using 1 μg/mL polybrene (Millipore). Antibiotic selection was performed using Puromycin at 5 μg/mL (Gibco ...
-
bioRxiv - Microbiology 2021Quote: T1L WT or T1L σ3 mutant virions (2×1012 particles per ml in 100 μl) were incubated with 10 μg/ml trypsin (Sigma) at 8°C in a MyCyclerTM thermal cycler (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: Dried polar samples were resuspended in 100 μL water and 2 μL were injected into a ZIC-pHILIC 150 x 2.1 mm (5 μm particle size) column (EMD Millipore). Chromatographic separation was achieved using the following conditions ...
-
bioRxiv - Microbiology 2022Quote: ... Metabolite sample (5 μL) was injected onto a ZIC-pHILIC 2.1 × 150 mm (5 μm particle size) column (EMD Millipore). Buffer A was 20 mM ammonium carbonate ...
-
bioRxiv - Cancer Biology 2022Quote: ... RMS cells were infected with viral particles for 24h at 37° C using 8 mg/mL of polybrene (EMD Millipore). Cells were selected for using 1 mg/ml G418 (Sigma ...
-
bioRxiv - Neuroscience 2019Quote: ... Chromatographic separation was done on a reversed-phase Kromasil C18 column (250 mm× 4.6 mm, 5 μm particle size) purchased from Sigma-Aldrich. The Shimadzu Nexera system was equipped with dual pumps ...
-
bioRxiv - Plant Biology 2019Quote: ... Chromatographic separations were conducted on a Discovery Bio wide-pore C18 column (150 μm I.D. × 150 mm length and 5 μm particle size; SIGMA, USA), using a linear gradient from 5% to 75% CAN in 0.1% formic acid at a flow rate of 2 μL min−1 ...
-
bioRxiv - Cell Biology 2019Quote: Undifferentiated SGBS cells were plated at 50 % confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG ...
-
bioRxiv - Immunology 2019Quote: ... THP-1 cells were infected with the supernatants contain lentiviral particles in the presence of 4 μg/ml polybrene (Sigma). After 48 h of culture ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stable MCF7 cell lines infected with the ERK5 cDNA lentiviral particles were generated by selection in medium containing puromycin at a concentration of 1 μg/mL (Sigma). PCR using primers (Table S3 ...
-
bioRxiv - Plant Biology 2019Quote: ... The gold particles were prepared by precipitating 5 μg of each DNA plasmid construct on to the gold particles with 625mM CaCl2 (Sigma) and 10mM spermidine (Sigma) ...
-
bioRxiv - Immunology 2020Quote: ... THP-1 cells were infected with the supernatants contain lentiviral particles in the presence of 4 μg/ml polybrene (Sigma). After 48 h of culture ...
-
bioRxiv - Immunology 2020Quote: ... THP-1 cells were infected with the supernatants contain lentiviral particles in the presence of 4 μg/ml polybrene (Sigma). After 48 h of culture ...