Labshake search
Citations for Millipore Sigma :
501 - 550 of 662 citations for Diphtheria Toxin CRM197 Mutant since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... followed by the incubation with fluorescein isothiocyanate (FITC)-cholera toxin B subunit (CTB; Sigma, C1655, 1: 1000 diluted in sterile PBS) for 1 hour at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... animals were sedated with ketamine (10mg/kg) and Cholera Toxin subunit B (CT-B, 10 µl, Sigma C9903, 1% aqueous (sterile)) was injected subcutaneously into the distal and middle finger pads of digits 1-3 of both hands ...
-
bioRxiv - Neuroscience 2021Quote: ... We gently lowered a glass capillary (Φ = 8 μm opening) in the targeted regions and slowly injected about 30 nl cholera toxin B subunit (CTB, 1%, Sigma-Aldrich) or virus ...
-
bioRxiv - Immunology 2021Quote: ... The Dil-labelled nanocarriers were visualised using the lipophilic dye excitation wavelength of 514 nm while plasma membranes were labelled with FITC-conjugated cholera toxin (Sigma, C1655) and visualised at the excitation wavelength of 488 nm ...
-
bioRxiv - Neuroscience 2021Quote: The left caudate nucleus of one monkey (not included in the behavioral study) was infused with the retrograde tracer cholera toxin B subunit (C9903, Sigma-Aldrich) via guide cannulae ...
-
bioRxiv - Cancer Biology 2022Quote: ... KB-derived cell lines were grown in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 supplemented with 10% FCS and 5 µg/mL Insulin 5 ng/mL cholera toxin and 5 ng/mL murine epidermal growth-factor (EGF, Sigma, #E4127). The HEK293FT cell line (RRID ...
-
bioRxiv - Immunology 2022Quote: ... Immunized mice were administered Pertussis toxin intravenously (iv) through the tail vein (250 ng/mouse: Sigma Aldrich, St. Louis, MO, USA) in a final volume of 100 µL on the day of immunization and 48 hours later ...
-
bioRxiv - Molecular Biology 2021Quote: ... and input TRF1 mutants were revealed with anti-His (anti 6-His Rabbit Pab Sigma Aldrich). For the detection of biotin-labelled PARylated proteins the same assay was conducted in presence of biotin-NAD+ (Sigma Aldrich ...
-
bioRxiv - Microbiology 2022Quote: Wild type and mutant CANC proteins were expressed in Escherichia coli Rosetta (DE3) cells (Merck Millipore) as previously described (Betancor et al. ...
-
bioRxiv - Biophysics 2020Quote: ... We reduce the thiols of cysteine residues in α-syn mutants by 2 mM DTT (Sigma) for 1 hour at room temperature ...
-
bioRxiv - Immunology 2019Quote: ... The Cps1-1 mutant was grown as described above but supplemented with 200 μM uracil (Sigma). Mature parasites were lysed from host cells by vigorous pipetting and egressed parasites were filtered through 3 μm polycarbonate membranes and resuspended in HHE medium (Hanks’ balanced salt solution ...
-
bioRxiv - Cell Biology 2019Quote: Purified Wss1 wildtype (3.1 μM) or various mutant alleles (3 μM) were incubated with ssDNA (Sigma) (5’GCGCGCCCATTGATACTAAATTCAAGGATGACTTATTTC3’ ...
-
bioRxiv - Genomics 2021Quote: ... 15 g/L agar) supplemented for mutant strains with hygromycin B (Sigma-Aldrich; 70 μg/ml) or nourseothricin (Werner Bioagents ...
-
bioRxiv - Microbiology 2021Quote: ATPase activity of EccA1 and EccA1 point mutants was measured with an ATPase/GTPase kit (Sigma) adapted for 384 well-plates ...
-
bioRxiv - Immunology 2021Quote: The ΔyopM mutant strain of Yersinia pseudotuberculosis 32777 was grown overnight in 2X YT media (Sigma) at 25°C with shaking at 200 rpm ...
-
bioRxiv - Microbiology 2023Quote: ... sclerotiorum KO and KI mutants were screened and purified on PDA supplemented with hygromycin B (Sigma) at a final concentration of 50 μg/ml.
-
bioRxiv - Molecular Biology 2023Quote: ... The Dbn1 mutant sequences were generated using the KOD Hot Start DNA Polymerase kit (Sigma-Aldrich), according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... the wild-type ScLas1 gene and its mutants were cloned into a modified pET23a vector (Novagen) with an N-terminal His6GST-tag ...
-
bioRxiv - Neuroscience 2022Quote: ... We injected each mouse with 100 μg/kg of toxin (Takeoka and Arber, 2019) diluted in ultrapure water (Millipore, TMS-006-C) and let the animals in a confined cage for three days ...
-
bioRxiv - Neuroscience 2020Quote: ... guanosine 5′-[γ-thio]triphosphate tetralithium salt (GTP-γ-S) and Pertussis toxin (PTX) were purchased from Sigma-Aldrich (St. Louis, MO), CGP 55845 ((2S)-3-[[(1S)-1-(3,4-Dichlorophenyl)ethyl]amino-2-hydroxypropyl] (phenylmethyl ...
-
bioRxiv - Zoology 2019Quote: The midgut tissue dissected out from continuous toxin-exposed susceptible and toxin exposed insects for 6 generations (n=5) were processed for RNA isolation using TRI reagent TM (Sigma Aldrich, USA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... cholera toxin B-subunit (CTB; C9903) and heat labile enterotoxin B subunit (LTB; E9656) of Escherichia coli were purchased from Sigma (Sigma Aldrich). PhenoVue Fluor 594-WGA was obtained from PerkinElmer (Perkin Elmer Health Science Inc ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated from wt and mutant embryos (n=30, for each genotype) using TRIzol (Sigma) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... The sifA mutant was plated in LB agar plates with Streptomycin (Sigma, final conc 100 μg/mL). The bacterial load was calculated as colony forming unit (cfu ...
-
bioRxiv - Microbiology 2021Quote: ATPase activity of Wt and mutant HelR proteins was determined using the colorimetric ATPase assay kit (Sigma). The ATP hydrolysis reaction was performed by incubating 0.3 µM HelR with 1 mM ATP (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... LtaA mutants were incubated for 3h at RT in the presence of 0.5 mM mPEG5K-Maleimide (Sigma) and 0.5% SDS ...
-
bioRxiv - Biophysics 2020Quote: ... The SgrS U224G mutant was grown in LB Broth with 50 μg/ml spectinomycin (Spec) (Sigma-Aldrich). The next day ...
-
bioRxiv - Biochemistry 2023Quote: Wild-type and mutant (K282S, R393S-R397S, K279S) SHMT1 genes were cloned into a pET22b(+) vector (Novagen) and expressed as N-terminal histidine-tagged fused protein in Escherichia coli (BL21-DE3) ...
-
bioRxiv - Neuroscience 2023Quote: Foxg1 mutant cells were obtained by administering tamoxifen (Cat #T5648) prepared in corn oil (Sigma; Cat #8267) to E15.5 hGFAPCreERT2 ...
-
Insight into the regulatory mechanism of the MFS transporter, SCO4121 by the MarR regulator, SCO4122bioRxiv - Molecular Biology 2024Quote: ... the WT SCO4122 and mutant M93L-SCO4122 proteins were transferred on to polyvinylidene difluoride (PVDF) membrane (Millipore) using transfer buffer (6g Tris base ...
-
bioRxiv - Biophysics 2021Quote: Spin-labeled BmrCD mutants were concentrated to 70-100 µM using Amicon Ultra-100 kDa centrifugal filters (Millipore) and incubated with nucleotides or Hoechst-33342 ...
-
bioRxiv - Biochemistry 2022Quote: ... Four out of eight WT and mutant samples were treated with proteinase K from Tritirachium album (Sigma Aldrich) (limited proteolysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein levels of wild-type or mutant Rad6 were determined by immunoblotting using anti-Flag M2 antibody (Sigma).
-
bioRxiv - Biophysics 2020Quote: ... The wt-p53 (1-321 aa) as well as its mutants were cloned into the pET23 vector (Novagen) and expressed in E ...
-
bioRxiv - Biophysics 2020Quote: ... Single- and double-mutant constructs of hERG were produced using conventional overlap PCR with primers synthesized by Sigma Genosys (Oakville ...
-
bioRxiv - Biochemistry 2022Quote: SV40-transformed human fibroblasts XP2OS (XPA mutant) were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Cytiva) supplemented with 10% fetal bovine serum (FBS, Millipore) and penicillin streptomycin (P/S ...
-
bioRxiv - Developmental Biology 2019Quote: Control and mutant embryonic cortices were dissected and dissociated into single cell suspension and digested with Acutase (Sigma). Cells were maintained in proliferation media (STEMCELL Technologies) ...
-
bioRxiv - Microbiology 2022Quote: Plasmids containing WT or mutant NS1 sequence were transfected into FreeStyle 293F cells using polyethylenimine (PEI) (40K) (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Expression of the eGFP protein and the PAK1 mutant was induced by doxycycline (2 μg/mL, Sigma-Aldrich, St ...
-
bioRxiv - Cell Biology 2023Quote: 2 μg GST-tagged NuSAP point mutants were incubated with 50 ng human recombinant Aurora A (Sigma-Aldrich) in a water bath at 30°C for 30 min in kinase buffer (50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2023Quote: ... VirB or its mutant variants were incubated with 5 mM Tris(2-carboxy-ethyl) phosphine (TCEP; Sigma, USA) for 1 h at room temperature to fully reduce all cysteine residues ...
-
bioRxiv - Neuroscience 2020Quote: ... mice were immunized with ONA (1 mg/ml) mixed with incomplete Freund’s adjuvants (FA) and 1 µg pertussis toxin (PTx; both Sigma Aldrich, St. Louis, MO, USA) according to the previously described pilot study (Reinehr et al. ...
-
bioRxiv - Immunology 2023Quote: ... 21 and 42 with 50 μg of each of five recombinant LMWs in alum mixed with 200 ng/mouse pertussis toxin (Sigma-Aldrich, #70323-44-3). ELISA was performed to measure serum responses to antigen (see methods below ...
-
bioRxiv - Cell Biology 2023Quote: DRMs distribution on the cell surface was assessed by staining the cells with cholera-toxin coupled to FITC (CT-FITC, Sigma-Aldrich, Burlington, MA, USA). The target of cholera toxin is GM1 (monosialotetrahexosylganglioside) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/mL epidermal growth factor (PreproTech, Catalog No. AF-100-15) and 10−10 M cholera toxin (Sigma-Aldrich, Catalog No. C8052-5MG). VdH15 cells were grown in KSFM medium supplemented with 25 μg/mL BPE and 0.5 ng/ml epidermal growth factor ...
-
bioRxiv - Biophysics 2021Quote: ... The collected fractions of spin-labeled BmrCD mutants were concentrated using an Amicon Ultra-100 kDa centrifugal filters (Millipore), and the final concentration determined by absorbance at 280 nm (Mean extinction coefficient = 68077.5 M−1 cm−1).
-
bioRxiv - Molecular Biology 2020Quote: Ten-month-old WT and mutant adult zebrafish were euthanized by hypothermic shock and fixed in Bouin’s solution (Sigma), then washed in 70% ethanol ...
-
bioRxiv - Plant Biology 2019Quote: ... Seeds (15 per mutant line) were surface sterilized by rinsing in 5% (v/v) Sodium Hypochlorite (Sigma Aldrich, UK) for 10 mins and were rinsed with water three times before being imbibed in 1.75 mL of water for 5 days at 4°C to ensure uniform germination ...
-
bioRxiv - Biochemistry 2020Quote: ... The WT and mutant plasmids were then transformed into Escherichia coli Rosetta™ 2(DE3)pLysS competent cells (Novagen) for protein expression.
-
bioRxiv - Biochemistry 2019Quote: The synergy of B8CYA8 and its mutants with commercial cellulase derived from Trichoderma viride (Sigma-Aldrich, St. Louis, USA) was measured on Avicel ...