Labshake search
Citations for Millipore Sigma :
4751 - 4800 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and 0.05% Triton X-100 (# X100, Sigma)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested by trypsinization (Trypsin-EDTA, Sigma-Aldrich), washed three times in PBS and resuspended in 10% glycerol PBS before snap freezing in liquid nitrogen and storage at -80 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10600002) or 0.2 µm or 0.45 µm PVDF membranes (Amersham Protron, 10600021 or Immobilon-P, Millipore, IPVH00010) for 1 h at 100 V in tris-glycine buffer with 10 % methanol ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit anti-Mns1 (Sigma-Aldrich Prestige Antibodies, HPA039975). Antibodies used in the zebrafish study are rabbit anti-HA (Santa Cruz ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse anti-acetylated-tubulin (Sigma, T6793), mouse anti-γ-tubulin (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse anti-γ-tubulin (Sigma, T6557), anti-mouse HRP conjugate (Promega ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse anti-γ-Tubulin (Sigma, T5326), rabbit anti-Mns1 (Sigma-Aldrich Prestige Antibodies ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse anti-acetylated Tubulin (Sigma, T6793), mouse anti-γ-Tubulin (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 mM nicotinamide (Sigma-Aldrich; N0636), 10 ng/ml human hepatocyte growth factor (in-house production) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 µM dexamethasone (Sigma-Aldrich; D1756), 10 mM nicotinamide (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... supplemented with 10 µg/ml DNase I (Sigma-Aldrich; DN25). Erythrocytes were lysed in red blood cell lysis buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... primary antibodies against α-tubulin at 1:5000 dilution (mouse, Sigma-Aldrich) and ubiquitin at 1:2000 dilution (mouse ...
-
bioRxiv - Developmental Biology 2024Quote: ... and ubiquitinylated proteins (clone FK2, mouse, Sigma-Aldrich) at 1:200 dilution were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... of NSC668394 (EMD Millipore; Oakville ...
-
bioRxiv - Developmental Biology 2024Quote: Germline nuclei isolation was performed by following a published protocol (70) except that worms were lightly fixed in 50 mL of −20°C dimethylformamide (Sigma-Aldrich) for 2 min and washed three times in PBS before homogenization ...
-
bioRxiv - Developmental Biology 2024Quote: ... the broad-spectrum hydroxamate metalloproteinases inhibitor CT1746 (100 µM) and the protease inhibitor cocktail (a mixture of aprotinin, bestatin, E-64, leupeptin and pepstatin A, 1/1000)(SIGMA, P1860) with or without 20 nM Wnt5a in the presence or absence of 500 nM RAP for 3 h at 37 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Dechorionated embryos or larvae were embedded in 1.5% low-melting agarose (ISC BioExpress) containing 0.01% tricaine (Sigma-Aldrich) within glass-bottom Petri dishes (MatTek Corporation) ...
-
bioRxiv - Molecular Biology 2024Quote: Antibodies used for immunoblotting in this study include rabbit polyclonal anti-GFP (ab290, Abcam, 1:2,500 or Sigma, G1544, 1:1000), mouse monoclonal anti-GFP (JL8 ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse monoclonal anti-FLAG HRP-conjugated (Sigma), and polyclonal anti-XND-1 (Wagner et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM DTT) using Amicon Ultra-15 3 K or 30 K centrifugation units (Merck Millipore). The phase separation assay was performed in the presence or absence of 10% polyethylene glycol 8000 (PEG-8000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5-ethynyldeoxyuridine (EdU, Sigma-Aldrich or Click Chemistry Tools) was at 10mM in DMSO ...
-
bioRxiv - Molecular Biology 2024Quote: ... Macrophages were characterized by cytospin and flow cytometry under basal conditions and following LPS (Sigma-Aldrich St. Louis, MO) stimulation (100 ng/nL for 72 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... We examined HIO under basal conditions and after 72-hour co-culture with 50,000 LPS (Sigma-Aldrich St. Louis, MO) primed (100 ng/mL ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... The day after seeding cells were treated with MBCD (Sigma C4555) at a concentration of 2.5 mM to deplete cells of endogenous cholesterol ...
-
bioRxiv - Developmental Biology 2024Quote: ... HEK293T culture media was collected at both 48 and 72 hours post transfection and concentrated using Amicon Ultra-15 columns (Millipore; UFC903024). ESCs were first transduced with lentiviral packaged pLX_311 and selected with Blasticidin (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: ... and phosphatase inhibitors (Sigma; 4906845001). The samples were centrifuged at 13,000rpm (∼15,000G) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and CD68 antibody (Sigma-Aldrich St. Louis, MO), co-stained with DAPI (Thermo Fisher Scientific Waltham ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... transferred to nitrocellulose or to polyvinylidene difluoride (PDVF) and probed with anti-SREBP2 clone 22D5 (Millipore Sigma, MAB1988) followed by anti-GAPDH (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2024Quote: ... to generate cDNA and performed qPCR using FastStart Universal SYBR Green Master (Sigma Aldrich). We used primers against Citrine (CGGCGACGTAAACGGCCACAAGTTCAG ...
-
bioRxiv - Developmental Biology 2024Quote: ... then embedded in glass capillary tubes with paired pistons (Sigma Z328510 paired with BR701938 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and Retinoic Acid (100 nM RA; Sigma #R2625) to the N2B27 differentiation medium from day 4 to day 9 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 103 units/ml ESGRO leukemia inhibitor factor (LIF) (EMD Millipore). N2a cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells dissociated using Accutase (Millipore) and plated at a density of 30,000/cm2.
-
bioRxiv - Molecular Biology 2024Quote: ... then horseradish peroxidase substrate (Immobulin, Millipore) was applied and then immediately imaged using a Biorad ChemiDoc imaging system.
-
bioRxiv - Molecular Biology 2024Quote: ... 165nM nocodazole (Millipore-Sigma #487928) was added for 12 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... The culture was then maintained on WR99210 (WR) (Sigma-Aldrich) until parasites could be seen in Giemsa smears ...
-
bioRxiv - Molecular Biology 2024Quote: ... thymidine (Sigma #T1895), bafilomycin A1 (MedChemExpress #HY-100558).
-
bioRxiv - Molecular Biology 2024Quote: ... cells were treated with 2 mM thymidine (Sigma #T1895) for 18 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 10% v/v of TSB (100 μl TSB to 900 μl medium, Sigma-Aldrich, Cat# 22090) for another 24 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... we topically applied 4 nmols of MC903 (Sigma, St.Louis, Missouri) or ethanol control onto the mouse ears once daily for 14 consecutive days ...
-
bioRxiv - Molecular Biology 2024Quote: ... Blue Dextran from the Gel Filtration Molecular Weight Markers Kit for Molecular Weights 29,000–700,000 Da (Sigma Aldrich) was used as a void volume marker and the six proteins (Albumin ...
-
bioRxiv - Molecular Biology 2024Quote: ... Anti-FLAG M2 magnetic beads (Sigma M8823) were washed with RIPA buffer before adding 1ul beads/1mg protein to protein samples and undergoing continuous inversion at 4°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.4mM PMSF) and the resulting lysate was incubated with M2 anti-FLAG affinity gel (Sigma A2220) for 2 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were extracted in quadruplicates using RIPA buffer (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Luminata™ western HRP substrate (Millipore) was applied to the membrane for visualization.
-
bioRxiv - Cancer Biology 2024Quote: ... reduced in 10 mM DTT for 1 h at 56 °C followed by alkylation with 55 mM iodoacetamide (Sigma) for 45 min in the dark ...
-
bioRxiv - Cancer Biology 2024Quote: ... and thrombin from bovine plasma (5 U/ml in PBS, Sigma), and added in the middle channel of the microfluidic chip ...
-
bioRxiv - Molecular Biology 2024Quote: The following compounds were added into the cell culture medium at final concentrations indicated in the figure legends: insulin (Sigma #I9278), EGF (Gibco #PHG0314) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the pellet was resuspended in ten times the pelleted volume of 5% D-sorbitol (Sigma-Aldrich), then incubated at 37°C for 5mins ...
-
bioRxiv - Molecular Biology 2024Quote: ... Slides were blocked with 3% w/v BSA (Sigma Aldrich) overnight and then washed three times in PBS ...