Labshake search
Citations for Millipore Sigma :
4451 - 4500 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Oocytes were enzymatically defolliculated in 3 mg/ml collagenase (Sigma) followed by washes in MBSH (88mM NaCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... and DNase I (#69182–3; Sigma Aldrich, 10 U/ml). For dissociating normal lung epithelial cells ...
-
bioRxiv - Cell Biology 2023Quote: Overnight invasion cultures were fixed in 3% glutaraldehyde (Sigma, MO) and stained with 0.1% toluidine blue in 30% methanol ...
-
bioRxiv - Evolutionary Biology 2023Quote: Zygotes were de-jellified using 3 % cysteine (Merck Millipore, USA), washed 6 times in N ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit polyclonal antibody to GluR2/3 (1:100; #AB1506; Millipore) or a rabbit polyclonal antibody to NPY (1:1000 ...
-
bioRxiv - Biophysics 2023Quote: ... 50 mM 3-(cyclohexylamino)-1-propanesulfonic acid (CAPS, Millipore Sigma), 0.3% N-lauroyl sarcosine (Millipore Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... Apoptosis was induced by adding 3 µM staurosporine (Sigma Aldrich) for 4 hours at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and DNase I (#69182–3; Sigma Aldrich, 10 U/ml) for 2 hours at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3% v/v heat-inactivated Human Male AB Serum (Sigma), 2 mg/ml Human Serum Albumin (HSA ...
-
bioRxiv - Developmental Biology 2023Quote: ... *Rabbit anti-caspase 3 active cleaved (1:1000, AB3623, Millipore).
-
bioRxiv - Immunology 2023Quote: ... and mixed with 20 μL of 0.15% 3-hydroxydiphenol (Sigma) in 0.5% NaOH ...
-
bioRxiv - Molecular Biology 2023Quote: ... Calu-3 cells were cultured in Advanced DMEM (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were blocked with 3% donkey serum (Millipore Sigma, D9663) in PBS for 2 hours at room temperature and incubated overnight at 4°C using the following concentrations ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 μL of 3 mg/mL Collagenase (Sigma-Aldrich, C6885) was added to the supernatant and the mixture was incubated at 37°C for 45 minutes under constant shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 µM 3-Isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich #I5879), and 1 µM dexamethasone (Gbiosciences ...
-
bioRxiv - Biochemistry 2024Quote: ... using 3:1 polyethylenimine (average Mw, ∼25,000 Da; Sigma-Aldrich) to total DNA ratio (4 μg BRSK and 2 μg TAU DNA ...
-
bioRxiv - Bioengineering 2024Quote: ... and phase-separated in 1-bromo-3-chloropropane (B9673, Sigma) [82,95] ...
-
bioRxiv - Neuroscience 2024Quote: D-4-amino-3-isoxazolidone (DCS, C3909 Sigma-Aldrich, UK) was prepared in sterile saline solution (6) ...
-
bioRxiv - Neuroscience 2024Quote: ... permeabilized for 30 min with 3% Triton-X (Millipore Sigma) in 1x PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μM Nigericin (Sigma-Aldrich, N7143, CAS: 28643-80-3), 2.5 μM Saliphenylhalamide (Salip ...
-
bioRxiv - Biophysics 2024Quote: ... 500 mM 3-(1-Pyridin)-1-Propansulfonat (NDSB-201; Sigma) for protein stabilisation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3% bovine serum albumin (w/v) (Sigma, A-7888) at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... and blocked (3% BSA (Bovine Serum Albumin, Sigma-Aldrich #A7030) and 0.1% Tween (Sigma-ldrich)) ...
-
bioRxiv - Cancer Biology 2024Quote: 3% poly-2-hydroxyethyl methacrylate (poly-HEMA; P3932, Sigma-Aldrich) solution was prepared in 95% absolute ethanol ...
-
bioRxiv - Neuroscience 2024Quote: ... phosphatase inhibitor cocktail 2 and 3 purchased from Sigma Aldrich, MO ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by endogenous peroxidase inactivation with 3% H2O2 (Sigma-Aldrich) and subsequently blocked in 5% BSA in TBS-T with TBS washes inbetween each step ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 mM DTT supplemented with 3 mM ATP (Sigma) and 3 mM MgCl2 ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and IBMX (3-Isobutyl-methylxanthine, 25µM, Sigma-Aldrich, Toluca Mexico) with ACSF was perfused for 25min ...
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Immunology 2024Quote: ... 0.3% Triton X-100 and 3% Bovine Serum Albumin (Sigma). Cells were stained with antibodies for 30m-1h at room temperature or up to overnight at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Phase separation was achieved with 1-bromo-3-chloropropane (Sigma), and the resulting aqueous phase was precipitated in isopropanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 mM MgCl2) containing 250 U/ml Benzonase (Sigma, E1014), 1X cOmplete EDTA-free protease inhibitor cocktail (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 µM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma-Aldrich), 100 µM ethylene glycol bis(succinimidyl succinate ...
-
bioRxiv - Physiology 2024Quote: ... stimulated with nicotine (Sigma Cat. # 6019-06-3, 50μg/ml), nicotine + angiotensin II (Tocris Cat ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by coating with 3 mg/ml Concanavalin A (Sigma) for 1 hour at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 mM 3-mBz (m-toluic acid, Sigma-Aldrich) to induce msfGFP production ...
-
bioRxiv - Genomics 2024Quote: ... 3) 30 seconds in Harris’ modified Haematoxylin solution (Sigma HHS16), 4 ...
-
bioRxiv - Microbiology 2024Quote: ... 50mg 3-(Acrylamido) phenylboronic acid (Sigma Aldrich Cat No. 771465), 1ml 10X RNase-free TAE ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently washed 3 times with PBS 2% FBS (Sigma). pDCs were enriched from freshly isolated PBMCs using the human Plasmacytoid Dendritic Cell Isolation Kit II (Miltenyi Biotec ...
-
bioRxiv - Bioengineering 2024Quote: ... a 2% 3-(Trimethoxysilyl)propyl methacrylate (TMSPMA, Sigma-Aldrich 440159) (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... the substrate was treated with (3-Aminopropyl) triethoxysilane (Sigma-Aldrich), diluted at 5% in absolute ethanol ...
-
bioRxiv - Biophysics 2021Quote: A 3 μL droplet of the 500 μM peptide solution was applied to glass slides and stained with a 10 mM Congo Red (Sigma©) solution in PBS (137 mM NaCl ...
-
bioRxiv - Microbiology 2019Quote: ... The eluted tryptic peptides were dried by speed-vacuum centrifugation and then desalted through ZipTip C18 Pipette tips (Millipore/Sigma-Aldrich). Samples were reconstituted in 10 µL of 0.1% formic acid before their analysis by nLC–MS/MS ...
-
bioRxiv - Microbiology 2019Quote: ... The eluted tryptic peptides were dried by speed-vacuum centrifugation and then desalted through ZipTip C18 Pipette tips (Millipore/Sigma-Aldrich). Samples were reconstituted in 10 µL of 0.1% formic acid before their analysis by nLC–MS/MS ...
-
bioRxiv - Developmental Biology 2021Quote: ... The FLAG tagged proteins were then eluted in the FLAG wash buffer containing a final concentration of 500 ng/μl of FLAG peptide (Sigma, F4799).
-
bioRxiv - Biochemistry 2020Quote: Peptides were desalted and concentrated with C18 ZipTips (10 μL pipette tip with a 0.6 μL resin bed; Millipore, MA, USA). Samples were dried and reconstituted in 25 or 50 μL 0.1% formic acid depending on the specific analysis ...
-
bioRxiv - Immunology 2022Quote: PBMC or expanded T cell lines were stimulated for 5h at 37°C with or without SARS-CoV-2 peptides (2 μg/ml) in the presence of 10 μg/ml brefeldin A (Sigma-Aldrich). Cells were stained with the yellow LIVE/DEAD fixable dead cell stain kit (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Two elution steps of the FLAG-tagged protein-DNA complexes were performed with 200 μL of FLAG buffer (TBS buffer plus 100 μg/ml of 3XFLAG peptide from Sigma-Aldrich) and the samples were incubated 30 min at RT on a rotating wheel (20 rpm) ...
-
bioRxiv - Genetics 2019Quote: ... We used the anti-HA high affinity monoclonal antibody from rat to recognize the HA-peptide (clone 3F10, ref 11 867 423 001, Sigma-Aldrich).
-
bioRxiv - Microbiology 2019Quote: ... Beads were washed 5 times in NP40 buffer and precipitated proteins were eluted by boiling with SDS sample loading buffer or elution with 3X FLAG peptide (Sigma-Aldrich). Whole cell lysates and immunoprecipitated samples were analyzed by western blot.