Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 5 Methyl 3 phenylmethylene 2 3H furanone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... phosphatase inhibitor cocktail 2 and 3 (Sigma), and cOmplete EDTA-free protease inhibitor cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2-3 mL mineral oil (M8410, Sigma) was used to fully overlay the droplets to prevent the evaporation.
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM Mg(Ace)2 (Sigma #63052), 10mM Tris-HCl (pH 8 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM Mg(Ace)2 (Sigma #63052), 10mM Tris-HCl (pH 8 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM Mg(Ace)2 (Sigma #63052), 10mM Tris-HCl (pH 8 ...
-
bioRxiv - Microbiology 2020Quote: ... indole-3-actic acid (Sigma, 2 mM) were freshly prepared for serial dilutions (10x ...
-
bioRxiv - Neuroscience 2022Quote: ... phosphatase inhibitor cocktails 2 and 3 (Sigma). Lysates sat on ice for 30min with intermittent vortexing ...
-
bioRxiv - Bioengineering 2021Quote: ... + 0.05 × 10−3 M 2-mercaptoethanol (Sigma)] supplemented with soluble anti-mouse CD28 (5 µg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-methylene-2-norbornanone (Sigma; Cat# M46055), lumiflavin (Cayman Chemical ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% 2-ethyl-3-methylpyrazine (Sigma W315508), 1% 2,5-dimethylpyrazine (Sigma 17542015) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1% phosphatase inhibitor cocktail 2 & 3 (Sigma) and protease inhibitor cocktail ...
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... phosphatase inhibitor cocktail 2 and 3 (Sigma) and benzonase (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and phosphatase inhibitors 2 and 3 (Sigma). Lysates incubated on ice for at least 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... β2/3 subunit (Millipore, catalog #: 05-474) (1:250 dilution) ...
-
bioRxiv - Bioengineering 2019Quote: ... any excess solution was carefully removed with a Kimwipe before being frozen in 2-Methyl Butane (Sigma-Aldrich). Each experiment was repeated five times ...
-
bioRxiv - Immunology 2019Quote: ... MEK1/2 inhibitor MEKi-A (AZD6244) was formulated in sterile vehicle with 0.5% (Hydroxypropyl)methyl cellulose (Sigma-Aldrich) and 0.1% polysorbate 80 (v/v ...
-
bioRxiv - Immunology 2022Quote: ... and 95% - for at least 2 hours each before incubation with a methyl salicylate solution (Sigma-Aldrich, M6752) for 30-60 minutes in a custom metal chamber with 0.2mm coverslip glass bottom ...
-
bioRxiv - Neuroscience 2023Quote: ... Brains were removed and rapidly frozen by immersing in 2-methyl butane (Cat. M32631, Sigma-Aldrich, Darmstadt, Germany) previously chilled in dry ice ...
-
bioRxiv - Neuroscience 2024Quote: LL-341070 was provided by Autobahn Therapeutics as a solution in 1% 1-methyl-2-pyrrolidone (Sigma 270458) and 1% Kolliphor HS 15 (Sigma 42966 ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Biophysics 2020Quote: ... (D9891), 2-aminoethoxydiphenyl borate (2-APB) (D9754) and poly(methyl methacrylate) (PMMA, Mw~15,000) (200336) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Thapsigargin (586005 ...
-
bioRxiv - Biochemistry 2022Quote: ... The mediators used in the potentiometric measurements were methyl viologen (1,1′-Dimethyl-4,4′-bipyridinium dichloride) and pyocyanin (5-Methylphenazin-1-one) also purchased from Sigma-Aldrich. Sodium hydrosulfite and potassium ferricyanide for potentiometric experiments were purchased from VWR.
-
Preferred endocytosis of amyloid precursor protein from cholesterol-enriched lipid raft microdomainsbioRxiv - Neuroscience 2020Quote: ... for 1 h and CHO PS1 ΔE9 cells were treated with 5 mM methyl-β-cyclodextrin (MβCD; Sigma, #332615) for 30 min.
-
bioRxiv - Systems Biology 2023Quote: ... Each cage was provided with a 30 ml glass bottle filled with a solution of 5% glucose and 0.4% methylparaben (methyl 4-hydroxybenzoate, Sigma). A vertically rolled up Whatman filter paper was inserted to soak up the sugar solution and allow mosquitoes to feed on.
-
bioRxiv - Cell Biology 2023Quote: For lipid raft disruption microglial cells were pre-incubated with 5 mM of methyl-β-cyclodextrin (MβCD) (Sigma-Aldrich) for 1 hour.
-
bioRxiv - Genomics 2019Quote: ... and 3 × 10−5 mM hydrocortisone (Sigma H0888) in 6 well plates (Figure 1) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Cell Biology 2019Quote: ... 10 µM 5-aza-2′-deoxycytidine (5’-aza-dC; Sigma) was added to the medium ...
-
bioRxiv - Developmental Biology 2020Quote: ... or 1000 nM of 2-(4-amino-1-isopropyl-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-1H-indol-5-ol (PP242; Sigma, P0037), (2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated in B2 with 2% nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP, Sigma) until adequate colour development ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then stained for 2 minutes at room temperature using filtered 0.5% Solvent Black 3 (CAS Number 4197-25-5; Sigma 199664) dissolved in 75% ethanol ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 µl of a solution of 5 mg/mL MTT [3-(4,5)-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (Sigma Chemical Co.) was added ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were exposed to 5 μM CHIR99021 (Axon) between days 2 and 3 and then supplemented with 100 nM RA (Sigma) until day 5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... after 72 hours of drug treatment, 20μl of a 5mg/mL 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (M2128-MTT; Sigma-Aldrich, USA) solution was added to each of the wells ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-GGTCAGCCAACTCGTCACAGTC-3’) and by alizarin red S staining with a 2% (w/v) alizarin red S solution (Sigma-Aldrich). Slides were imaged in an Olympus BX61 microscope ...
-
bioRxiv - Cell Biology 2021Quote: Confluent ESCs monolayers were decidualized in DMEM/F12 containing 2 % FBS supplemented with 0.3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP) (Sigma-Aldrich, USA), 10 nM β-Estradiol (E2 ...
-
bioRxiv - Bioengineering 2022Quote: ... with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...