Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 5 Methyl 3 phenylmethylene 2 3H furanone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... The full length coding sequence of AdACS1/2/3 and AdACO3/5 were inserted into pET-32a (Novagen) vector and then transferred into Escherichia coli strain BL21 (DE3) ...
-
bioRxiv - Neuroscience 2022Quote: ... we delivered the Iκ-kinase inhibitor [5-(p-Fluorophenyl)-2-ureido]thiophene-3-carboxamide (TPCA-1; Sigma-Aldrich CAS 507475-17-4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Larvae were incubated overnight from 4 dpf in 3 ml 10 mM 5-Bromo-2′-deoxyuridine (B5002, Sigma) with 1% DMSO for 17 hours ...
-
bioRxiv - Microbiology 2023Quote: ... After 24 hrs media/inhibitor was aspirated and replaced with 20 μl of 5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) (Sigma) and incubated at 37 °C in 5% CO2 for 3 hrs ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μL MTT (5 mg/ml tetrazolium salt 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, Sigma-Aldrich) was added to each well and kept in a dark for 4 hours at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... animals received daily intraperitoneal (I.P) injections of L3,4-dihydroxyphenylalanine methyl (L-DOPA, 3 day at 3mg/kg, then 6mg/kg, Sigma-Aldrich) and the peripheral DOPA decarboxylase inhibitor bensezaride hydrochloride (12mg/kg ...
-
bioRxiv - Microbiology 2023Quote: ... embryos were mechanically dechorionated and anaesthetized in 0.02 % (w/v) buffered 3-aminobenzoic acid methyl ester (pH 7.0) (Tricaine, Sigma-Aldrich). Zebrafish embryos were individually infected by microinjection with 1 nl of P ...
-
bioRxiv - Physiology 2020Quote: ... or n-[2,2’,3,3’-3H] octanoic acid (American Radiolabeling Chemicals) and 22 μM of unlabeled non-esterified fatty acids respectively (Sigma-Aldrich). For long-chain fatty acid oxidation ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 3-MA (M9281, Sigma), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Biochemistry 2021Quote: ... 5(6)-carboxyfluorescein (3 eq, Sigma-Aldrich) was activated with PyAOP (3 eq ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Biophysics 2022Quote: ... We dissolve 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methyl-morpholinium chloride (DMTMM) powder (Sigma Aldrich) in HEPES buffer (pH 7.18 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Neuroscience 2019Quote: ... 25-40 animals were incubated for 3h at 20°C in 5% (w/v) of blue food dye (Erioglaucine disodium salt, Sigma-Aldrich) in E ...
-
bioRxiv - Plant Biology 2020Quote: ... for 3h or 1 μM Concanamycin A (Sigma-Aldrich) for 6h to inhibit the proteasome and autophagy ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 or 10 minutes with 100 µM N-Methyl-D-aspartic acid (NMDA, Sigma-Aldrich, St. Louis, MO). Cortical neurons were seeded in T-75 flasks (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5% 2-mercaptoethanl (Sigma) by incubating the beads at 100°C for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 5% 2-mercaptoethanol (Sigma) and fractionated by SDS-PAGE using the Mini-PROTEAN Tetra System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol (Sigma), and incubated at room temperature instead of boiled ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’-GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’-AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Methyl-β-cyclodextrin (MβCD) (Sigma, 332615) for depletion of membrane cholesterol and soluble cholesterol (Sigma ...
-
bioRxiv - Genomics 2020Quote: ... Methyl Green-Pyronin (MGP, Sigma Aldrich) was used to monitor the release of intact nuclei ...
-
bioRxiv - Microbiology 2019Quote: ... or methyl-β-cyclodextrin (332615, Sigma). After 24 h treatment ...
-
bioRxiv - Cell Biology 2020Quote: ... methyl benzimidazol-2yl carbamate (MBC; Sigma) from a 2.5 mg/mL stock in DMSO was added to cultures at 25°C to a final concentration of 25 µg/mL MBC and 1% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: Methyl-β-cyclodextrin (MβCD; Sigma C4555) was dissolved in TMCM and used at 10 mM ...
-
bioRxiv - Biophysics 2020Quote: ... Methyl-β-cyclodextrin (MβCD; Sigma-Aldrich) was used to remove the DPC detergent from the protein-detergent-lipid mixture ...
-
Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwaybioRxiv - Cell Biology 2022Quote: ... methyl-β-cyclodextrin (Sigma Aldrich, C4555), G418 (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 μM methyl myristate (Sigma-Aldrich) was used as the internal standard.
-
bioRxiv - Biochemistry 2022Quote: ... To test metsulfuron-methyl (MM) (Sigma) sensitivity ...
-
bioRxiv - Immunology 2022Quote: ... bestatin methyl ester (MeBs; Sigma, 200485), MLN4924 (Cayman ...
-
bioRxiv - Molecular Biology 2020Quote: ... or methyl methanesulfonate (MMS) (Sigma-Aldrich) in BCDAT medium ...
-
bioRxiv - Neuroscience 2022Quote: ... Methyl-β-Cyclodextrin (C4555, Sigma, 250μM) and Cytochalasin D (PHZ1063 ...
-
bioRxiv - Physiology 2022Quote: ... methyl-piperidinopyrazole (MPP, Sigma-Aldrich, USA), the most selective estrogen receptor alpha (ERα or ESR1 ...
-
bioRxiv - Plant Biology 2019Quote: ... methyl jasmonate (MeJ, Sigma-Aldrich, #392707) was prepared in 0.1% Tween-20 ...
-
bioRxiv - Biochemistry 2019Quote: ... or L-methionine-methyl-13CD3 (Sigma) at the final concentration of 0.1 mM ...