Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for 5 Methyl 3 phenylmethylene 2 3H furanone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... were place on the plate and 10 μL of (1, 2, 4 and 9.8 M) H2O2 and (2, 4, 6 M) methyl viologen (Sigma-Aldrich, UK) was dispensed onto each separate disk ...
-
Proteasome granular localization is regulated through mitochondrial respiration and kinase signalingbioRxiv - Cell Biology 2022Quote: ... and 2-[2-(3-chlorophenyl)hydrazinylidene]-propanedinitrile (CCCP) (Sigma), were used at final concentrations of 0.5 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-[2-(3-chlorophenyl)hydrazinylyidene]propanedinitrile (CCCP) (Sigma-Aldrich), rhodamine 123 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2-4 months old mice were orally gavaged with 3 x 2 (Mist1creERT/+KRASG12D/+) or 5 x 5 mg (Ptf1acreERT/+KRASG12D/+) of tamoxifen (TX; Sigma-Aldrich, T5648-5G) at Western University and 5 x 4 mg (Ela-creERT ...
-
bioRxiv - Biophysics 2021Quote: ... methyl viologen from Sigma (856177), and COT from Sigma (138924) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Methyl-thiazol tetrazolium (MTT, Sigma) was added to cells at a concentration of 5 mg/mL for 4 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... and methyl pyruvate (Sigma-Aldrich) experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... and methyl cellulose (Sigma, M7140) were made in Bonner’s Salts at 50 mg/mL ...
-
bioRxiv - Molecular Biology 2019Quote: ... Methyl methanesulfonate (MMS) (Sigma 129925) was treated as 100% ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... methyl methanesulfonate obtained from Sigma Chemical Co ...
-
bioRxiv - Cell Biology 2021Quote: ... methyl-β-cyclodextrin (Sigma, C4555), γ-cyclodextrin (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... methyl-jasmonate (Sigma, 40 mM), salicylic acid (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... methyl-beta-cyclodextrin (MβCD) (Sigma), cholesterol (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... methyl-β-cyclodextrin (332615, Sigma), recombinant bacterial sphingomyelinase (S7651 ...
-
bioRxiv - Neuroscience 2022Quote: ... Methyl-β-Cyclodextrin (MβCD) (Sigma), phosphoinositide-3 kinase (PI3Kinase ...
-
bioRxiv - Cell Biology 2022Quote: ... Methyl blue 1 min (Sigma). Between different stains slides were washed with dH2O ...
-
bioRxiv - Microbiology 2021Quote: ... or methyl methanesulphonate (MMS, Sigma). Plates were incubated for 48h in a gassed chamber at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: Methyl methanesulfonate (MMS, Sigma, 129925), Nitrofurazone (NFZ ...
-
bioRxiv - Bioengineering 2020Quote: ... and methyl green (Sigma-Aldrich) with a goat pAB to Rb IgG (HRP ...
-
bioRxiv - Developmental Biology 2020Quote: ... dissolved in methyl salicylate (Sigma)) ...
-
bioRxiv - Plant Biology 2019Quote: ... methyl jasmonate (45 μM) (Sigma), and aminocyclopropanecarboxylic acid (660 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% methyl salicylate (Sigma W274502), 1% (+)-carvone (Sigma 22070) ...
-
bioRxiv - Cell Biology 2021Quote: ... Hydroxyurea and methyl methanesulfonate (Sigma) were supplemented in the media as noted in the figure legends ...
-
bioRxiv - Molecular Biology 2022Quote: ... methyl methane sulfonate (Sigma-Aldrich), hydroxyurea (BioBasics) ...
-
bioRxiv - Cell Biology 2022Quote: ... methyl metanosulfonate (129925, Sigma-Aldrich), zeocin (R25001 ...
-
bioRxiv - Biochemistry 2023Quote: Methyl-β-cyclodextrin (MβCD; Sigma) was dissolved in a serum free media (Pro293A-CDM ...
-
bioRxiv - Biophysics 2024Quote: Methyl-β-cyclodextrin (MβCD, Sigma) was dissolved in DMEM ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910), ATP (Sigma-Aldrich A2383) ...
-
bioRxiv - Physiology 2019Quote: ... whole brains were frozen for 1 minute in −35°C 2-methyl-butane (Isopentane, Sigma-Aldrich) and stored at −80°C ...
-
bioRxiv - Genetics 2019Quote: Rapamycin (LC-Laboratories, R-5000) and benomyl (methyl 1-[butylcarbamoyl]-2-benzimidazolecarbamate; Sigma Aldrich, PCode 1002355429) were dissolved in DMSO at a concentration of 1 mM and 30 mg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... Dactolisib was freshly solved in N-Methyl-2-Pyrrolidone (NMP; Sigma-Aldrich, Darmstadt, Germany, Cat# 328634) and Polyethylene glycol 300 (PEG300 ...
-
bioRxiv - Immunology 2023Quote: ... and/or 4 μM N,N,N’,N’-tetrakis-(2-pyridyl-methyl)-ethylenediamine (TPEN; Sigma, #P4413) was added to the cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Developmental Biology 2024Quote: ... We anesthetized embryos in 160 μg/mL tricaine and embedded them in 5% methyl cellulose (Sigma-Aldrich) or 1% NuSieve GTG low-melt agarose ...
-
bioRxiv - Cell Biology 2023Quote: – 5-iodo-2’-deoxyuridine (IdU) and 5-Chloro-2′-deoxyuridine (CldU) (Sigma-Aldrich) were dissolved in sterile DMEM at 2.5mM and 200mM respectively and stored at –20°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 mM 5-Fluro-2’-deoxyuridine (SIGMA U3003). Cells were transfected at DIV17-19 with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5’-fluoro-2’-deoxyuridine (Sigma, 5 μM) were added to the culture medium at days in vitro (DIV ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 5-Fluro-2’-deoxyuridine (SIGMA U3003). Cells were transfected at DIV17-19 with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... The solvent was evaporated under a stream of nitrogen before adding 5 ml of a 5 mM (6.55 mg/ml) solution of methyl-β-cyclodextrin (Sigma 332615, Mn∼1310) prepared in Buffer A ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The starting materials methyl 4-nitrobutyrate and methyl 4- oxobutanoate were obtained commercially (Sigma-Aldrich). Compounds CP-24 to CP-30 were formed by transesterification of dimethyl CP-23 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and eosin (Sigma HT110-2-3) for two minutes each ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or (2) Gill’s Haematoxylin #3 (Sigma), rinsed in 70% ethanol ...
-
bioRxiv - Cell Biology 2022Quote: ... β2/3 (Millipore, catalog #: 05-474), or γ2 (Synaptic Systems ...
-
bioRxiv - Molecular Biology 2021Quote: ... adenosine-2′,3′-dialdehyde (AdOx) (Sigma) or equal volume of DMSO vehicle was added to cells for 24 hours at a final concentration of 20 µM.
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Developmental Biology 2024Quote: ... phosphatase inhibitors 2 and 3 (Sigma) and protease inhibitor cocktail (Complete ...