Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... N-acetyl-L-alanine (Sigma, A4625-1G), N-acetyl-β-alanine (ThermoScientific ...
-
bioRxiv - Biochemistry 2024Quote: ... N-acetyl-L-phenylalanine (Sigma, 857459-5G), N-acetyl-L-tyrosine (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... n-Acetyl-cysteine (1.25 mM, Sigma, A9165), EGF (50 ng/ml ...
-
bioRxiv - Microbiology 2023Quote: Purified N-Acetyl-D-lactosamine (Sigma-Aldrich) was diluted in PBS to 1000 μM ...
-
Red Algae-Derived Mineral Intervention to Counter Pro-inflammatory Activity in Human Colon OrganoidsbioRxiv - Molecular Biology 2022Quote: ... 1 mM N-Acetyl-L-cysteine (Sigma), 10 mM HEPES (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 10mM N-acetyl L-Cysteine (Sigma A9165), 55μM 2-Mercaptoethanol (Thermo Fisher 21985023) ...
-
bioRxiv - Microbiology 2023Quote: ... anti-acetyl-histone H3 (06-599B; Millipore), anti-phospho-histone H3 (ser10 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1.25mM N-acetyl cysteine (Sigma-Aldrich A9165), 10mM nicotinamide (Sigma-Aldrich N3376) ...
-
bioRxiv - Microbiology 2023Quote: ... and 5µg/ml N-acetyl trypsin (Sigma), 5mM HEPES buffer and 1% agarose was added ...
-
bioRxiv - Cell Biology 2022Quote: ... and N-Acetyl-L-cysteine (Sigma, A9165), cells incubated in the drug or vehicle (cell culture grade water ...
-
bioRxiv - Cell Biology 2023Quote: ... N-acetyl-L-cysteine (1 mM, Sigma), recombinant Wnt3a protein (100 ng/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... N-Acetyl-L-cysteine (Sigma-Aldrich, A9165), EGF (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM N-acetyl-L-cysteine (Sigma), 100 ng/mL noggin (R&D systems) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM N-acetyl-L-cysteine (Sigma), 100 ng/mL Noggin (R&D systems) ...
-
THE OLFACTORY RECEPTOR Olfr78 REGULATES DIFFERENTIATION OF ENTEROCHROMAFFIN CELLS IN THE MOUSE COLONbioRxiv - Cell Biology 2023Quote: ... 1 mM N-acetyl cysteine (Sigma Aldrich), 50 ng/ml EGF ...
-
bioRxiv - Immunology 2023Quote: ... Acetyl H3 (EMD Millipore CORP #06-599), Acetyl H4 (Sigma-Aldrich #06-866) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1.25 mM N-Acetyl-L-Cysteine (Sigma) and 100 μg/mL Primocin (Bio-Connect) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.25mM N-acetyl-L-Cysteine (Sigma Aldrich), 10mM nicotinamide (sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2024Quote: ... acetyl-Histone H3 (1:10,000, Rabbit, Millipore).
-
bioRxiv - Cancer Biology 2024Quote: Rabbit anti-acetyl-Histone H3 Antibody (Millipore) were pre-bound to magnetic SureBeads (BioRad ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM N-acetyl cysteine (Sigma, A8199), 10 µM SB431542 (STEMCELL Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... 1.25mM N-acetyl cysteine (#A7250, Sigma-Aldrich), and 100U/ml penicillin-streptomycin ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 200 µM acetyl-CoA (Sigma #A2181) ±250ng of Oct4 in 20 mM Tris pH 7.4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.25mM N-acetyl-L-cysteine (Sigma-Aldrich), 20 ng/ml bFGF (PeproTech) ...
-
bioRxiv - Cell Biology 2024Quote: ... 25 μm N-acetyl-L-cysteine (Sigma); IVC-2 ...
-
bioRxiv - Cell Biology 2024Quote: ... N-Acetyl-L-cysteine 1.25 mM (Sigma), L-glutamine 2 mM (Life Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1mM N-acetyl-cysteine (Sigma-Aldrich #A9165) and 1x conditioned media (derived from L-WRN cells) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 mM N-acetyl cysteine (Sigma Aldrich), 10 μM Trolox (Millipore) ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM 2-hydrocycitrate (2-HC) (Sigma) was added to cell culture at indicated time points ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Microbiology 2022Quote: ... 3 days post-infection 4 mL of paraformaldehyde 4% (#158127, Sigma) was added and incubated overnight at 4ºC ...
-
bioRxiv - Microbiology 2021Quote: ... individuals were placed in a microtube containing in 100 µl of either Schneider’s media (Experimental Replicates 1 and 2) or RPMI media (Experimental Replicates 3 and 4) to which 2% Penicillin/Streptomycin and Amphotericin B (Sigma-Aldrich, Dorset, UK) had been added ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910), ATP (Sigma-Aldrich A2383) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2-4 months old mice were orally gavaged with 3 x 2 (Mist1creERT/+KRASG12D/+) or 5 x 5 mg (Ptf1acreERT/+KRASG12D/+) of tamoxifen (TX; Sigma-Aldrich, T5648-5G) at Western University and 5 x 4 mg (Ela-creERT ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2020Quote: ... 6–8-week-old C57BL/6N mice were anesthetized by inhalation of isoflurane (3–4%) or intraperitoneal injection of 2% Avertin solution (2,2,2-tribromoethyl alcohol dissolved in Tert-amylalcohol (Sigma)) dissolved in saline ...
-
bioRxiv - Microbiology 2022Quote: ... polymyxin B sulfate and 2-Heptyl-3-hydroxy-4(1H)-quinolone (PQS) (Sigma-Aldrich Corp., St. Louis, MO) were dissolved in water ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mg of 4-OHT (Sigma H7904) were dissolved in 120μl of ethanol ...
-
bioRxiv - Immunology 2022Quote: ... We used 3-4 synthetic sgRNAs (Sigma) per gene ...
-
bioRxiv - Microbiology 2023Quote: ... 4-azidobenzoic acid (6427-66-3, Sigma), propidium iodide powder (25535-16-4 ...
-
bioRxiv - Biophysics 2024Quote: ... 4% (3-Aminopropyl) triethoxysilane (APTES) (Sigma-Aldrich)-treated and 2% glutaraldehyde (Sigma-Aldrich)-activated 35mm glass-bottom dishes (Ibidi ...
-
bioRxiv - Microbiology 2021Quote: ... as well as 10 mM apramycin (approximately 5 mg/ml) and 10 mM acetyl-CoA sodium salt (Sigma Aldrich). The assay mixtures were incubated at 37°C for 20 minutes.