Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Plant Biology 2021Quote: ... lapachol (2-hydroxy-3-(3-methyl-2-butenyl)-1,4-naphthoquinone) were purchased from Sigma-Aldrich. Vismione H and madagascine were obtained from PGE2 fraction of Psorospermum glaberimum as previously described (Gallé ...
-
bioRxiv - Immunology 2021Quote: ... The animals were then subjected to increasing doses of methacholine (0.1, 0.3, 1, 3, 10, 30mg/mL) (a broncho-constrictor; acetyl-β methacholine chloride; Sigma-Aldrich) delivered by an ultrasonic nebuliser ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM 2-hydrocycitrate (2-HC) (Sigma) was added to cell culture at indicated time points ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Microbiology 2022Quote: ... 3 days post-infection 4 mL of paraformaldehyde 4% (#158127, Sigma) was added and incubated overnight at 4ºC ...
-
bioRxiv - Microbiology 2021Quote: ... individuals were placed in a microtube containing in 100 µl of either Schneider’s media (Experimental Replicates 1 and 2) or RPMI media (Experimental Replicates 3 and 4) to which 2% Penicillin/Streptomycin and Amphotericin B (Sigma-Aldrich, Dorset, UK) had been added ...
-
bioRxiv - Biophysics 2020Quote: ... and 150 nM Acetyl coenzyme A (Sigma) in a 96 well plate ...
-
bioRxiv - Cell Biology 2022Quote: ... N-Acetyl-Cysteine (NAC) (A9165, Sigma-Aldrich) was used directly after infection at 1 mM ...
-
bioRxiv - Bioengineering 2022Quote: ... N-acetyl cysteine (500 μM; Millipore Sigma), nicotinamide (10 mM;Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1mM N-Acetyl-L-cysteine (Sigma A9165), 2500 units/mL Penicillin and 2.5 mg/mL streptomycin (0.05 mg/mL) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1mM N-Acetyl-L-cysteine (Sigma A9165), 10nM Nicotinamide (Sigma Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... 1mM N-acetyl cysteine (Sigma Aldrich A9165), 100 μg ml−1 Primocin (Invivogen ant-pm-1) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 10 μM N-acetyl-cystine (Sigma) or ImmunoCult™-XF T Cell Expansion Medium (StemCell) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mM N acetyl cysteine (Sigma-Aldrich), 50 ng/ml EGF and 100 ng/ml Noggin (both from Peprotech) ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-acetyl-α-tubulin (Sigma-Aldrich, T6793), anti-ATG5 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... N-acetyl-L-Cysteine (Sigma Aldrich, USA), p38 MAPK inhibitor SB 202190 (Cayman Chemical Co. ...
-
bioRxiv - Microbiology 2020Quote: ... and 5ug/ml N-acetyl trypsin((Sigma)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1 mM N-acetyl cysteine (Sigma). PDxOs were embedded into Matrigel (growth factor reduced ...
-
bioRxiv - Cell Biology 2021Quote: ... 1.25 mM N-Acetyl-L-cysteine (Sigma), 10 nM Gastrin I (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.25 mM N-acetyl cysteine (Sigma-Aldrich), 5 mM nicotinamide (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.25 mM N-Acetyl-L-cysteine (Sigma), 10 nM Gastrin I (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Acetyl-H3 (1:1000, Millipore, 06-599), Histone H3 (1:1000 ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 mM N-acetyl cysteine (Sigma-Aldrich), 10 μM zinc sulfate and 10 μg.ml-1 of heparin sulfate ...
-
bioRxiv - Neuroscience 2021Quote: ... 5ug/ml N-acetyl cysteine (Sigma, A8199), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... NAC (N-Acetyl-L-cysteine, Sigma, A9165), BSO (L-Buthionine-sulfoximine ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1.25mM N-acetyl-cysteine (Sigma, Cat: A9165), 10mM Nicotinamide (Sigma ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 10mM N-acetyl L-Cysteine (Sigma, A9165), 55μM 2-Mercaptoethanol (Thermo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-acetyl histone H3 (Millipore 06-599), anti-H2A (Active Motif ...
-
bioRxiv - Developmental Biology 2021Quote: ... N-acetyl-L-cysteine (1 mM, Sigma), Wnt3a-conditioned medium (50% v/v) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 10mM N-Acetyl-L-cysteine (Sigma) and cultured in a 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1mM N-acetyl cysteine (Sigma; A8199-10G); 10µM Activin Inhibitor (SB 431542 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1.25 mM n-Acetyl Cysteine (Sigma-Aldrich).
-
bioRxiv - Immunology 2021Quote: ... N-acetyl-L-cysteine 1μM (Sigma-Aldrich). 500μL of crypt media was changed every other day and maintained at 37C in fully humidified chamber containing 5% CO2.
-
bioRxiv - Immunology 2020Quote: ... and 10mM N-Acetyl-L-cysteine (Sigma). T cells were seeded at a density of 2×105 cells per well of U-bottom 96-well plates ...
-
bioRxiv - Neuroscience 2020Quote: ... and N-acetyl-L-cysteine (Sigma #A8199).
-
bioRxiv - Synthetic Biology 2023Quote: ... 10mM N-acetyl L-Cysteine (Sigma A9165), 55μM 2-Mercaptoethanol (Thermo Fisher 21985023) ...
-
bioRxiv - Microbiology 2023Quote: ... anti-acetyl-histone H3 (06-599B; Millipore), anti-phospho-histone H3 (ser10 ...
-
bioRxiv - Microbiology 2023Quote: Purified N-Acetyl-D-lactosamine (Sigma-Aldrich) was diluted in PBS to 1000 μM ...
-
Red Algae-Derived Mineral Intervention to Counter Pro-inflammatory Activity in Human Colon OrganoidsbioRxiv - Molecular Biology 2022Quote: ... 1 mM N-Acetyl-L-cysteine (Sigma), 10 mM HEPES (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1.25mM N-acetyl cysteine (Sigma-Aldrich A9165), 10mM nicotinamide (Sigma-Aldrich N3376) ...
-
bioRxiv - Microbiology 2023Quote: ... and 5µg/ml N-acetyl trypsin (Sigma), 5mM HEPES buffer and 1% agarose was added ...
-
bioRxiv - Biochemistry 2024Quote: ... N-acetyl-L-glutamine (Sigma, A9125-25G), N-acetyl-L-histidine (Alfa Aesar ...
-
bioRxiv - Biochemistry 2024Quote: ... N-acetyl-L-asparagine (Sigma, 441554-1G), N-acetyl-L-lysine (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... N-acetyl-L-cysteine (Sigma, A7250-25G), N-acetyl-L-glutamic acid (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... N-acetyl-L-alanine (Sigma, A4625-1G), N-acetyl-β-alanine (ThermoScientific ...
-
bioRxiv - Biochemistry 2024Quote: ... N-acetyl-L-phenylalanine (Sigma, 857459-5G), N-acetyl-L-tyrosine (Sigma ...