Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... (D-Ala(2)-mephe(4)-gly-ol(5))enkephalin (DAMGO, Sigma-Aldrich, Cat. No. E7384) at 50 µM or lipopolysaccharide (LPS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2024Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′-TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous references (PPIA ...
-
bioRxiv - Biophysics 2024Quote: ... respectively: EcoEF7,3_For: 5’-GCACTATTTGCTATATATTGTGTGGTTGAATCTTTTTTCAACTACATCTAGTATCTC-3’ and EcoEF7,3_Rev: 5’-GAGATACTAGATGTAGTTGAAAAAAGATTCAACCACACAATATATAGCAAATAGTGC-3’ were ordered from Sigma-Aldrich, resuspended and annealed in buffer containing 10 mM Tris pH 7 ...
-
bioRxiv - Molecular Biology 2022Quote: ... filter at 18 °C to 4 mg ml-1 and acetylated with acetyl phosphate (lithium potassium salt, Sigma) at final concentration 20 mM at 24 °C for 3 h ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-4 mg/ml biocytin (Sigma); pH∼7.2 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-4 mg biocytin (Sigma-Aldrich) was included in the intrapipette solution for morphological reconstruction ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were washed 2-3 times with warmed PBS followed by 50 μM 5-chloro-2’-deoxyuridine (CldU, Sigma #C6891) for 20 minutes or 50 μM CldU with 4mM hydroxyurea (HU ...
-
bioRxiv - Cell Biology 2024Quote: ... 2-Hydroxy-4’-(2-hydroxyethoxy)-2 methylpropiophenome (Sigma Aldrich) photoactivator was suspended in S Basal (final concentrations of all components ...
-
bioRxiv - Immunology 2022Quote: Fabs (2-4 mg/ml) were mixed with a 2 to 3-fold molar excess of fen-G4 or fentanyl (Sigma F-013) in Dulbecco’s PBS and incubated for 1-2 hours at 4 °C ...
-
bioRxiv - Neuroscience 2020Quote: A stock solution (74.8 mM) of the MEK inhibitor 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one (PD98059, PD hereafter, Sigma-Aldrich, Argentina) was conserved at −20 °C and freshly diluted in DMSO to the desired concentration (11.22 mM ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3% 2-Hydroxyethyl Agarose (Sigma) was prepared and stored in a water bath at 45 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 and 3 (Sigma-Aldrich). The homogenate was sheared through a 26-gauge needle and sonicated three times for 20-second bursts ...
-
bioRxiv - Plant Biology 2022Quote: ... 3% 2-mercaptoethanol (Sigma Aldrich), and 0.25 mg/ml Proteinase K (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) for 15 min at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... and trans-4-Phenyl-3-buten-2-one (20a) were purchased from Sigma-Aldrich (St. Louis, MO). Ketoisophorone (2a ...
-
bioRxiv - Bioengineering 2021Quote: Before staining with either 5-bromo-4-chloro-3′-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, Sigma-Aldrich) for alkaline phosphatase (ALP ...
-
bioRxiv - Developmental Biology 2021Quote: ... and color was developed with 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT; Sigma). Following color development ...
-
bioRxiv - Neuroscience 2022Quote: ... AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptors were blocked using 6,7-dinitroquinoxaline-2,3-dione (DNQX, Sigma) dissolved in dimethyl sulfoxide and diluted by 1000 in aCSF for 10μM bath application.
-
bioRxiv - Microbiology 2022Quote: ... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bands were stained in 5-bromo-4-chloro-3-indolyl-phosphate and nitro blue tetrazolium solution (Sigma-Aldrich). The membrane image was acquired using a digital steel camera EOS M6 mark II with a lens EF16-35 mm F4L IS USM (Canon Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... 5 × 10−5 M 2-mercaptoethanol (Sigma), and 1% penicillin-streptomycin ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μM 4-hydroxy tamoxifen (4-HT; Sigma) was added at the time of activation.
-
bioRxiv - Systems Biology 2022Quote: ... Fenofibrate (2-[4-(4-Chlorobenzoyl)phenoxy]-2-methylpropanoic acid isopropyl ester) (Sigma # F6020) was injected peritoneally (4% DMSO/PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng/mL interleukin-4 (IL-4, Sigma-Aldrich) and 0.5 μg/mL anti-CD180 (BD PharMingen) ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were incubated for 5 min with a 4’,6-diamidino-2-phenylindole (DAPI) solution (Sigma) to stain cell nuclei ...
-
bioRxiv - Physiology 2024Quote: ... samples were incubated with 5 µg/mL 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS ...
-
bioRxiv - Plant Biology 2020Quote: ... buffer (1 mM HEPES pH 7.3, 0.02% BSA) containing 50 mM acetyl co-enzyme A (Acetyl-CoA; Sigma) at 23 °C for 3 hours (wild type H3.1 ...
-
bioRxiv - Immunology 2021Quote: The livers of freshly-sacrificed mice were perfused retrogradely via the IVC(3) with 3 ml of PBS and then 10 ml of 2% paraformaldehyde (Sigma, catalogue# 30525-89-4) in PBS ...