Labshake search
Citations for Millipore Sigma :
4351 - 4400 of 7955 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... coding sequence was PCR-amplified from genomic DNA (DSM number 40517) and inserted into a modified version of pET-28a(+) (Novagen), which encodes the recognition sequence for Tobacco Etch Virus (TEV ...
-
bioRxiv - Neuroscience 2020Quote: ... the coding region corresponding amino acid 321-475 of dHtt protein was amplified by PCR and cloned into pET28b expression vector (Novagen). To generate anti-CG8134 antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... allele-specific PCRs were performed on 2 µl crude buccal DNA in a total of 10 µl using the REDExtract-N- AmpTM PCR ready MixTM (Sigma) according to the manufacturer’s protocol using 0.5 µM forward ...
-
bioRxiv - Genomics 2022Quote: ... Conserved regions were amplified from genomic leaf DNA in a standard polymerase chain reaction (PCR) using specific primers synthesized commercially (Sigma). PCR products were labeled with biotin-16-dUTP or digoxigenin-11-dUTP using BioPrime CGH array labelling kit (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... were amplified by PCR from genomic DNA and cloned into the NcoI/NotI restriction sites of the pET28a vector (Novagen). The constructs were overexpressed in E ...
-
bioRxiv - Neuroscience 2022Quote: ... First-strand synthesis was then performed by incubation at 25 °C for 10 min and 50 °C for 50 min on a PCR cycler with 7.6 μl of the following mix: 0.2 μg actinomycin D (Sigma-Aldrich, A1410), 13.15 mM DTT (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2022Quote: ... The 2827-bp PCR product was digested with EcoRI and HindIII and cloned into EcoRI-HindIII-digested pETDuet-1 vector (Novagen) lacking two nucleotides upstream from the BamHI site ...
-
bioRxiv - Genetics 2019Quote: ... Minigenes were constructed by DNA assembly of PCR fragments that were amplified from HEK293T genomic DNA using KOD Hot Start DNA polymerase (Novagen). For the wild-type minigene ...
-
bioRxiv - Cell Biology 2019Quote: ... Biosensors were either made in their original plasmid or in form of PCR fusion-product and were sub-cloned in the pTriEx-4neo vector (Novagen) under NcoI and BamH1 site ...
-
bioRxiv - Cell Biology 2020Quote: ... the cDNAs were amplified by PCR introducing NdeI restriction sites at the start codons and recloned with vector pET30a (Novagen) yielding chimeric fusion constructs with C-terminal hexahistidine-tags.
-
bioRxiv - Physiology 2019Quote: ... for synthesizing the probes was amplified using the primers described in Table S3 as following: the PCR reaction was set with KOD hot start master mix (#71842, Novagen), according to the manufacturer’s instructions and subsequently purified (#28706 ...
-
bioRxiv - Immunology 2021Quote: ... genomic DNA was extracted from ear clips and amplified by polymerase chain reaction (PCR) using the relevant forward (FP: 5’AAACTGGGCTCTCCGCTGCTG3’) and reverse (RP:5’AGTAGAGTATCGTGCATGGTCCTGG3’) primers (Taq polymerase (Sigma) at an annealing temperature (Tm ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA clones of VF1-mutant viruses that included either a single or a triple stop codon in ORF4 were generated by PCR mutagenesis using KOD hot start DNA polymerase (Novagen). The MNV-3 M1 mutant was generated by inserting a stop codon ...
-
bioRxiv - Systems Biology 2020Quote: ... respectively by transformation with a 1890 bp PCR amplified dig1Δ0::hyg allele and selection on hygromycin B (200 μg/ml) (Sigma Aldrich,) medium ...
-
bioRxiv - Biochemistry 2020Quote: ... encoding the cpeB gene from Prochlorococcus marinus MED4 was PCR amplified with primers (Table 4) encompassing selected recognition sites (EcoRI, HindIII) for cloning into pCOLADuet (Novagen).
-
bioRxiv - Molecular Biology 2019Quote: ... for each pSmChE were amplified from each full-length template by PCR and cloned into the pET41a expression vector (Novagen) such that the N-terminal GST tag was removed ...
-
bioRxiv - Microbiology 2021Quote: ... A PCR master mix was prepared using 10 µL KAPA SYBR FAST qPCR Master Mix (2X) (Sigma-Aldrich, Gillingham, UK), 0.4 µL ROX High ...
-
bioRxiv - Immunology 2020Quote: ... Each region of the protein was amplified via PCR and fragments were combined using Gibson assembly into pET28 vector (Millipore) for expression in E ...
-
bioRxiv - Immunology 2020Quote: ... The specificity of amplification was verified by size visualization of the PCR product (Table 1) after electrophoresis on a 1.8% agarose gel (Sigma-Aldrich) in 1% TBE (Tris-borate-EDTA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... plasmid DNA was linearized with XhoI or HindIII and purified using Montage PCR filter units and Micropure EZ column (Millipore). For pronuclear injection of FVB embryos ...
-
bioRxiv - Developmental Biology 2022Quote: ... Each cDNA was PCR-amplified and ligated between the SacI and KpnI sites of pRSF_Duet1 (Millipore Sigma, Burlington, MA, USA) with an N-terminal 6x histidine tag and a C-terminal Strep-II tag.
-
bioRxiv - Plant Biology 2022Quote: ... Expression levels were quantified by quantitative PCR in triplicate reactions from three biological replications using SYBR Green JumpStartTaq ReadyMix (SIGMA) with the standard run conditions for the ABI 7900 HT ...
-
bioRxiv - Plant Biology 2022Quote: ... The 981-bp PCR product was digested with BamHI and HindIII and cloned into BamHI-HindIII-digested pETDuet-1 vector (Novagen), giving pMS977 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 μg of genomic DNA were used for PCR reaction with primer 495 and 489 (Supplemental Table 1) with Red taq (Sigma) with the following PCR condition ...
-
bioRxiv - Molecular Biology 2022Quote: ... yejASm lacking the fragment encoding the first 30 amino acids (signal peptide) was PCR-amplified from Sm1021 genomic DNA and cloned into a pET29b(+) vector (Novagen) generating a C-terminal 6His-tag ...
-
bioRxiv - Microbiology 2024Quote: ... to introduce a KpnI site without changing the amino acid sequence by PCR from pTagRFP-N1 65 and cloning it into pFlag-CMV2 (Sigma). pFlag-TagRFP-KanS ...
-
bioRxiv - Microbiology 2022Quote: ... NSm and the entire pcDNA3.1 vector encoding Gn with an N-terminal SS plus HA tag were amplified by PCR using KOD Hot Start DNA polymerase (Novagen), mixed and then concatenated using the NEBuilder HiFi assembly kit according to the manufacturer’s instructions to yield pSnH-OROV-M ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were performed in 25μL volumes in a 0.2mL tube containing 12.5μL REDTaq® ReadyMix™ PCR Reaction Mix (Sigma-Aldrich R2523), 10.5μL ddH2O ...
-
bioRxiv - Developmental Biology 2023Quote: ... Single ICMs were individually transferred into PCR tubes containing 5 μL of lysis buffer (0.1 μL Triton X-100 (10% v/v in water, Sigma-Aldrich); 1.2 μL dNTP mix (25 mM each ...
-
bioRxiv - Microbiology 2023Quote: ... gene was PCR amplified from individual spores with primers AML225 (GAACCCAAACACTTTGGTTTCC) and WANDA26 (CAGCCGCGGTAATTCCAGCT) using JumpStart RedTaq DNA Polymerase Master Mix (Sigma). PCR products were sent for cleaning and Sanger sequencing (Macrogen Europe) ...
-
bioRxiv - Microbiology 2023Quote: ... were obtained by PCR with the primers P1-P2 and P2-P4 respectively (Supplementary Table 2) and cloned into pETDuet-1 (Novagen) using the In-Fusion HD Cloning system (Clontech) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... All PCR products were then purified from 1% agarose gels using Amicon Ultrafree-DA columns (Millipore Corporation, Bedford, MA, USA) and sequenced on both strands using the polymerase chain reaction primers with the Big Dye Terminator cycle sequencing kit on an Applied ABI Prism 3130XL automated sequencer ...
-
bioRxiv - Neuroscience 2023Quote: A 3 bp mutation was introduced into the CMV:dreammist-GFPpA by inverse PCR using specific primers (Table 2) and KOD high fidelity hot start polymerase (Millipore 71085). The template was degraded by DpnI digest and circular PCR product was transformed into OneShot TOP10 chemically competent E coli (Invitrogen C4040) ...
-
bioRxiv - Biochemistry 2023Quote: ... the supernatant was transferred to a fresh microtube and 1 μl was used as template DNA for a 25 μl PCR reaction (KOD HotStart, Millipore) to amplify the Nanobody insert using primers NbLib-fwd-i (CAGCTGCAGGAAAGCGGCGG ...
-
bioRxiv - Biophysics 2022Quote: ... into the WT-CaM construct in the pET21a vector using standard PCR mutagenesis after residue D80 of the protein sequence using primers ordered from Sigma-Aldridge (Merck) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Genotyping of mutant fish was performed by isolating genomic DNA from adult fish by swabbing64 and running PCR using KOD HotStart polymerase (Novagen) following standard protocol with 100 ng of DNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... the PCR products were used as templates for in vitro transcription of DIG-labeled RNA probe using T7 RNA polymerase (SIGMA) and DIG RNA Labeling Mix (SIGMA ...
-
bioRxiv - Cell Biology 2023Quote: ScMIC10-FLAG was amplified by PCR using the oligonucleotides 40/41 and integrated into the EagI/XbaI restriction sites of pFLAG-CMV5.1 (Sigma Aldrich).
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Immunology 2023Quote: The serotyped PCR products visualised under UV light were cut from the agarose gel using x-tracta Tool (Sigma Aldrich). The excised DNA fragments were further refined using nucleospin gel and by using PCR clean-up kit (Macherey-Nagel ...
-
bioRxiv - Plant Biology 2023Quote: ... This gene was amplified by PCR and inserted via In-Fusion system (TOYOBO) into the NdeI and XhoI sites of pET22b(+) (Novagen). Primers are listed in Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... The polymerase chain reaction (PCR) was run using 0.2 U/μL of KOD Hot Start DNA polymerase (Novagen, Cat# 71316), 0.3 μM each of primers ...
-
bioRxiv - Molecular Biology 2024Quote: cDNAs of BTB domains were PCR-amplified using corresponding primers (Supplementary Table S1) and cloned into modified pET32a(+) vector (Novagen) encoding TEV protease cleavage site after 6xHis-tag and Thioredoxin ...
-
bioRxiv - Cell Biology 2023Quote: ... the stonewall coding sequence was amplified by PCR and cloned into the XhoI and NcoI sites of the pET28a vector (Novagen). The plasmid was transformed into E.coli BL21(DE3 ...
-
bioRxiv - Biochemistry 2024Quote: ... coli including a polyhistidine tag and thrombin cleavage site at its N-terminus was amplified via PCR and subcloned into pET-30b (Novagen) between the NdeI/ BamHI sites (Vermot et al. ...
-
bioRxiv - Microbiology 2024Quote: ... PCR reactions used to create DNA fragments for allelic exchange were performed using KOD Hot Start DNA Polymerase (EMD Millipore) and cloned into pLT0675 ...
-
bioRxiv - Biochemistry 2024Quote: A DNA consisting of 2 base pairs-Widom 601 sequence (145 base pairs)-2 base pairs was amplified by PCR using a 5’-/6-FAM forward primer (Sigma). The PCR products were pooled from four 96-well PCR plates (100 µL per well ...
-
bioRxiv - Biochemistry 2024Quote: The sequence for each nanobody was amplified by PCR from the yeast surface display vector and cloned into pET26b (Novagen) with a C-terminal hexahistidine tag by Gibson assembly ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were fixed with 3.7% paraformaldehyde and washed 3 times with PBS before and after incubation with mouse anti-FLAG M2 primary antibody (Sigma, diluted 1:2000 in PBS with 1% BSA) or HRP-conjugated anti-mouse IgG secondary antibody (GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: ... The treated samples were washed again with TBST 5 times the second day and mounted with PBS+50% glycerol supplemented with DAPI (Sigma, D9542, 1 μg·mL−1, St. Louis, MO, USA) or H33342 nuclear dye (Sigma ...