Labshake search
Citations for Millipore Sigma :
4301 - 4350 of 7955 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... a 2.25-kb fragment containing the PHOT1 CDS was amplified by PCR with KOD hot start DNA polymerase (Novagen) using PHOT1 FW and PHOT1 RV primers (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product was digested with restriction enzymes and then ligated into pET-17b (Merck Millipore, Burlington, MA, USA) to construct the expression vector pStSOR ...
-
bioRxiv - Microbiology 2022Quote: ... hawaiiensis NRRL 15010 were obtained by ligating PCR-amplified gene sequences with linearized pET11a or pET22b vectors (Merck-Novagen), respectively ...
-
bioRxiv - Immunology 2019Quote: ... Cell lines were confirmed as mycoplasma negative before their use in experiments using a PCR-based assay (Sigma Aldrich).
-
bioRxiv - Neuroscience 2020Quote: ... 15792 single microglia were collected in 384-well PCR plates containing cell lysis buffer (0,2% Triton (Sigma-Aldrich, T9284), 4 U RNAse inhibitor (Takara ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli genes for proteins bS6 and bL9 were PCR-amplified and cloned individually into the pET28(a) plasmid (Novagen). Recombinant single-cysteine proteins were then expressed ...
-
bioRxiv - Genomics 2021Quote: ... First-strand synthesis was then performed by incubation at 25 °C for 10 min and 50 °C for 50 min on a PCR cycler with 7.6 μl of the following mix: 0.2 μg actinomycin (Sigma A1410), 13.15 mM DTT (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... Mutagenic primers were used to amplify pFA6a-mto2S338N-C-KanMX6 using the Expand High Fidelity PCR system (Millipore Sigma). The PCR product was digested with DpnI and transformed into NEB 5-alpha Competent E ...
-
bioRxiv - Molecular Biology 2022Quote: ... the gene encoding Cas7-11 was amplified by PCR and cloned into the modified pACYCDuet-1 plasmid vector (Novagen), expressing Cas7-11 with an N-terminal maltose-binding protein (MBP ...
-
bioRxiv - Cell Biology 2022Quote: ... OGG1 sequence was PCR amplified from pPR71 (8) cloned into NdeI/EcoRI sites of the overexpression vector pET30a (Novagen). The recombinant pET30a-hOGG1 was used as a template to introduce Y203A and N149A/N150A (referred to as 2NA ...
-
bioRxiv - Genomics 2022Quote: ... Puromycin or neomycin-resistant cell clones were screened by genomic PCR using KOD Xtreme hot-start DNA polymerase (Millipore).
-
bioRxiv - Microbiology 2022Quote: ... PCR products (10 μL) were visualized by gel electrophoresis in 1% (w/v) agarose gels (Sigma-Aldrich, Darmstadt, Germany). Sequencing was performed (LGC Genomics GmbH ...
-
bioRxiv - Plant Biology 2022Quote: ... were also amplified by PCR using the primers listed in Supplemental Table 2 and cloned into pGEX4T-1 (Novagen) using BamHI/EcoRI sites to N-terminal glutathione S-transferase (GST ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting PCR product was digested with XhoI and NcoI and introduced into the pET-28a vector (Merck Millipore). The ModA E165A ...
-
bioRxiv - Molecular Biology 2023Quote: ... We verified candidate plasmids using colony PCR using primers listed in Supplemental Table 2 and REDTaq ReadyMix (Sigma-Aldrich). All plasmids were miniprepped (QIAGEN ...
-
bioRxiv - Developmental Biology 2023Quote: ... Single embryos were transferred using a mouth-pipette from the imaging dish into PCR tubes containing 10μl lysis buffer composed of PCR buffer (Fermentas, EP0402) supplemented with 0.2 mg/ml Pro teinase K (Sigma, P8811). Embryos in the lysis buffer were incubated at 55°C for 1 hour and then at 96°C for 10 minutes ...
-
bioRxiv - Pathology 2023Quote: ... cDNA was measured by quantitative PCR with FastStart Universal SYBR Green Master (Rox) (04913850001, Sigma-Aldrich, St. Louis, MO) using QuantStudio 6 (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were loaded directly onto a 2% TAE agarose gel with GelRed Nucleic Acid Gel Stain (Sigma-Aldrich) for electrophoresis ...
-
bioRxiv - Plant Biology 2024Quote: ... The resulting 438-bp PCR product was digested with BamHI and HindIII and cloned into the pETDuet vector (Novagen) (pMS1079) ...
-
bioRxiv - Microbiology 2020Quote: ... The assay was performed using a commercial kit (Duolink In Situ Red Starter kit Mouse/Rabbit, #DUO92101, Sigma-Aldrich) following the instructions of the manufacturer ...
-
bioRxiv - Cell Biology 2022Quote: ... HDAC Activity Assay Kit (#566328) and In Situ HDAC Activity Fluorometric Assay Kit (#EPI003) were purchased from Sigma Aldrich, Germany ...
-
bioRxiv - Physiology 2020Quote: ... and each circulating hormones were determined using a commercially available ELISA kit for total ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-91K, Millipore), and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit ...
-
bioRxiv - Microbiology 2020Quote: ... The concentrations of all three nitrogen species were determined using fluorometric assay kits according the manufacturers protocol (Ammonia Assay Kit, Sigma-Alrdrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... EV were labeled with a PKH67 dye labeling kit-green (or PKH26 dye labeling kit-red) following the manufacturer’s instructions (Sigma-Aldrich). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... Cytokine and chemokine levels were measured with a commercial rat cytokine/chemokine magnetic bead panel 96-well plate assay kit (Milliplex MAP kit, Merck Millipore), which detects 5 cytokines and chemokines including IP-10/CXCL10 ...
-
bioRxiv - Microbiology 2023Quote: ... Bacteriophage DNA was isolated using the Phage DNA Isolation Kit (Norgen) and plasmids were isolated with the GenEluteTM Plasmid Miniprep Kit (Sigma). DNA purification from agarose gel or enzymatic reactions was performed with the NucleoSpin Gel and PCR clean up kit (Macherey-Nagel) ...
-
bioRxiv - Bioengineering 2023Quote: ... and creatine kinase (CK) levels were assessed using the Lactate Dehydrogenase Activity Assay Kit and Creatine Kinase Activity Assay Kit (Sigma), respectively ...
-
bioRxiv - Plant Biology 2020Quote: ... and hybridized overnight at 38°C with 32P-labeled probes for the intergenic region (IR) of the viral genome amplified by PCR (Fw: TCCTCTTTAGAGAGAGAACAATTGGGA, Rv: ACAACGAAATCCGTGAACAG) or oligonucleotides in PerfectHyb buffer (Sigma). Washed membranes were exposed to X-ray films at −80 °C for 3 days.
-
bioRxiv - Microbiology 2020Quote: ... The amplified PCR products were digested with NdeI and XhoI restriction endonucleases and subsequently cloned into the pET28a vector (Novagen). Confirmation of the correct nucleotide sequence of pelX was achieved through DNA sequencing (ACGT DNA Technologies Corporation) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1143-1300 of human RTEL1 were amplified by PCR then subcloned between the EcoRI and XhoI restriction sites of pET28 (Novagen). RTEL1 proteins were expressed as 6-histidine-fusions in the E ...
-
bioRxiv - Cell Biology 2020Quote: The open reading frame of clik-1 cDNA was amplified with reverse-transcriptase-PCR and cloned at the NdeI - BamHI sites of pET-3a (Novagen) with no extra tag sequence ...
-
bioRxiv - Cell Biology 2020Quote: ... the pronuclei were transferred to 0.2 ml PCR tubes in 3 μl sample buffer covered with mineral oil (Sigma-Aldrich) and were decrosslinked at 65°C overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... using PCR fragment amplified from pCAG-MV-GagPol-INKV1772-CTEx2 (44, 45) and NdeI/XhoI-linearized pET-22b(+) (Millipore Sigma). MVV IN proteins and human LEDGF/p75 were produced in bacteria and purified as previously described (1) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was PCR amplified from a FANTOM clone (AK139786) and cloned into NdeI and XhoI sites of the pET19b vector (Novagen).
-
bioRxiv - Molecular Biology 2021Quote: ... of wild-type Rad6 or an A126 mutant was PCR amplified and inserted by SLIC into BamH1-Not1 sites in bacterial expression vector pRSF-Duet (Novagen). Subsequently ...
-
bioRxiv - Plant Biology 2019Quote: ... the 1823 bp CDT1a promoter and the 1577 bp 5’ moiety of gCDT1a gene were amplified by PCR using the KOD polymerase (Millipore) and domesticated into the pUPD2 ...
-
bioRxiv - Cell Biology 2019Quote: ... 1690–1937) were amplified by PCR from the full-length cDNA and sub-cloned into pET28-a (+) or pET28-b (+) (Novagen). Human Nup58FG-N (aa ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR of tetur01g11270 fragments (amplicon 1 and 2) was conducted using the Expand™ Long Range dNTPack (Sigma-Aldrich). PCR reaction mixtures were prepared according to the manufacturer’s instructions and using the following temperature profile ...
-
bioRxiv - Developmental Biology 2019Quote: ... Repair templates and DNA fragments for cloning were generated by PCR amplification with either High Fidelity Hot Start KOD DNA Polymerase (Novagen) or Phusion Hot Start DNA Polymerase (Finnzymes) ...
-
bioRxiv - Genetics 2019Quote: ... 1000 ng of PCR-generated repair template and 5 µl (10 µg/µl) of salmon sperm carrier DNA (Sigma #D7656) and the tube was incubated on a turning wheel at 30°C for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA sequence corresponding to sim-PD (aa 361-672) was PCR amplified and cloned in-frame with a 6xHis-Tag into a modified pET-14b plasmid (Novagen). The expression plasmid was transformed into BL21 competent E ...
-
bioRxiv - Genetics 2020Quote: ... All products of the sequencing PCR were cleaned via passage through individual Sephadex clean up columns (Sigma-Aldrich, Gillingham, UK), to remove any unincorporated dye terminator products and diluted with 10µl of DNA free water ...
-
bioRxiv - Neuroscience 2021Quote: All primers were provided from Thermo Fisher and the REDExtract-N-Amp PCR Reaction Mix™ reagent used for the polymerase reaction was provided from Sigma-Aldrich® ...
-
bioRxiv - Biochemistry 2020Quote: ... Each protein encoding DNA fragment was assembled with the mCherry-PCR fragment and NdeI and HindIII digested pET22b vector (Novagen), using a Gibson assembly reaction (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 550 bp region from the mouse (FVB/NJ and BALB/cJ) Nup210 promoter covering the polymorphic sites was amplified by PCR using KOD Hot Start DNA Polymerase (Millipore) and digested with KpnI (New England Biolabs ...
-
bioRxiv - Biophysics 2020Quote: ... was PCR amplified from previously described pCDFDuet-1-RUVBL2 plasmid (Lopez-Perrote et al., 2012) and inserted into pET21b vector (Novagen) using the IVA cloning system (Garcia-Nafria et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR products were incubated at 95 °C for 3 min and cooled on ice followed by 5 μl of each PCR product being added to 18 μL of formamide (Sigma) and 2 μL of Genescan 500 Rox Size Standard (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... for each SmChE were amplified from each full-length template by PCR and cloned into the pET41a expression vector (Novagen) such that the N-terminal GST tag was removed ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNAs were PCR-amplified using specific primers (Table 1) and a JumpStart REDTaq ReadyMix Reaction Mix (Sigma-Aldrich, MO, USA). α-tubulin and water (“no DNA” ...
-
bioRxiv - Microbiology 2020Quote: ... The construction of baculovirus transfer vectors encoding hVP3 mutant polypeptides were generated using PCR-based site directed mutagenesis on the pFB/hisVP3 plasmid (Kochan et al. 2003) using synthetic DNA oligonucleotide primers (Sigma) described in Supplementary Table 1 ...