Labshake search
Citations for Millipore Sigma :
4001 - 4050 of 7813 citations for rno mir 148b 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Lactate Colorimetric Assay Kit (Sigma-Aldrich) was used according to the manufacturer’s instructions.The Seahorse Bioscience XFe96 Extra-cellular Flux Analyzer platform was employed to analyze the mitochondrial oxygen consumption rate (OCR ...
-
bioRxiv - Developmental Biology 2023Quote: ... using the Digoxigenin labeling kit (Sigma). Hybridized Digoxigenin-labeled probe was visualized with peroxidase-linked anti-Digoxigenin followed by NBT/BCIP substrate.
-
bioRxiv - Cell Biology 2023Quote: ... cholesterol quantitation kit (#MAK043, Sigma-Aldrich) and triglyceride quantification kit (#MAK266 ...
-
bioRxiv - Cell Biology 2023Quote: ... Duolink PLA assay kit (Sigma Aldrich) protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... Kits were purchased from EMD Millipore Corporation ...
-
bioRxiv - Cell Biology 2023Quote: ... ALP staining kit (S5L2-1KT, Sigma) was used for the staining and the manufacturer’s protocol was followed ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the lipid peroxidation kit (Sigma) was added to the cells at a final concentration of 10 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... and Golgi isolation kit (Sigma, GL0010). Pierce™ cell surface protein biotinylation and isolation kit (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... fluorescent cell linker midi kit (Sigma) was used according to manufacturer instructions to label murine mammary carcinoma cell lines ...
-
bioRxiv - Biochemistry 2024Quote: ... the F6P assay kit (Sigma-Aldrich) was used to measure the amount of F6P before and after treating the crude cell extracts with 0.1M HCl and incubated at 37°C for 30 mins ...
-
bioRxiv - Biochemistry 2024Quote: The lactate assay kit (Sigma, MAK066) is a colorimetric assay that measures lactate concentration (0.2–10 nmoles of lactate ...
-
bioRxiv - Cancer Biology 2024Quote: ... The SYBR Green QPCR kit (Sigma) was used with the following primers ...
-
bioRxiv - Cancer Biology 2024Quote: ChIP Assay Kit (Millipore, Bedford, MA) was used according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... A Creatinine Assay Kit (Sigma-Aldrich) was used to measure creatinine in the urine in accordance with the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... Leukocyte (TRAP) Kit (Sigma-Aldrich, 387A) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2024Quote: ... and Triglyceride assay kit (Sigma#T2449) respectively ...
-
bioRxiv - Microbiology 2024Quote: SOD Assay Kit-WST (Sigma, USA) was employed to measure superoxide dismutase (SOD ...
-
bioRxiv - Physiology 2024Quote: ... and DAB Substrate kit (#D3939, Sigma). HA was assessed as previously described[5] ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Straight-chain compounds were identified by comparing retention times and mass spectra with authentic standard mixture (C6-C40) (Supelco® 49452-U, Sigma-Aldrich, St. Louis, MO). Methyl-branched alkanes ...
-
bioRxiv - Neuroscience 2021Quote: ... Fixed brain samples were placed securely one a time in an MR-compatible holder immersed in proton-free susceptibility matching fluid (FluorinertTM FC-70; Sigma-Aldrich, St-Louis, MO, USA). In order to assess volume differences throughout the mouse brain ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7) gradient (20%, 40%, 60%, 80%, 100%), incubated 3 times (1h, o/n, 2h) in 100% dichloromethane (DCM) (Sigma-Aldrich, St. Louis, MO, USA) to remove hydrophobic lipids ...
-
bioRxiv - Zoology 2022Quote: ... and sorted on the basis of their mass spectra and retention time by comparison with standards (alkane standard solutions, Sigma-Aldrich, Saint Louis, MO, USA) and published spectra (NIST Library) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were then washed for three times with 1 X PBS and mounted using an antifade mounting media (Sigma-Aldrich Corp. St. Louis, MO, USA) in 8-well chamber slides (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Immunology 2023Quote: ... After 30 minutes incubation at room temperature the plate was washed 4 times with PBST and alkaline phosphatase substrate was added (Sigma Aldrich, S0942; St. Louis, MO). The plate was analyzed using a plate reader ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Biochemistry 2024Quote: ... the chamber was rinsed three times with T50 to remove non-specific interactions and a protocatechuic acid/recombinant protocatechuate-3,4-dioxygenase (Sigma Aldrich and Oriental Yeast Co., respectfully) (PCA/rPCD ...
-
bioRxiv - Microbiology 2023Quote: A colorimetric assay kit determined total indole content (Indole Assay Kit MAK326, Sigma-Aldrich, St. Louis, USA). Before measurement ...
-
bioRxiv - Pathology 2023Quote: ... osteoclasts were evaluated by TRAP staining using a commercially available kit (Acid Phosphatase TRAP kit, Sigma–Aldrich), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... 200µl supernatants transferred to a 96 well PCR plate and treated with 4U of almond beta-glucosidase (Sigma) at 37°C for 1.5 h ...
-
bioRxiv - Microbiology 2019Quote: All PCR reactions used for cloning were performed with high fidelity KOD Hot Start DNA Polymerase (EMD Millipore). Approximately 100 bp of upstream flanking DNA and the coding regions of OG1RF_10820 ...
-
bioRxiv - Cell Biology 2021Quote: ... The two tensin fragments were amplified individually by PCR using KOD Xtreme™ Hot Start DNA Polymerase (Sigma) and were run on 1% agarose gel along with the linearized vector ...
-
bioRxiv - Biophysics 2020Quote: ... Single- and double-mutant constructs of hERG were produced using conventional overlap PCR with primers synthesized by Sigma Genosys (Oakville ...
-
bioRxiv - Cell Biology 2021Quote: ... A plasmid encoding for TrxHis-Cobl-like1-411 was generated by PCR and subcloning into pET-32 (Novagen) (primers ...
-
bioRxiv - Microbiology 2022Quote: ... tuberculosis H37Rv genomic DNA by polymerase chain reaction (PCR) using primers that were synthesized by Sigma (Table S3). Hybrid combinations of genes or introduction of affinity tags were achieved with the use of nested primers ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative PCR was performed for the amplification of cDNAs using the appropriate primers (Sigma-Aldrich, see Table S2) and the GoTaq® qPCR Master Mix (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: qPCR (q-PCR) primers were designed using Universal probe library Assay Design Center and were purchased from Sigma. Transcriptor High Fidelity cDNA Synthesis Kit (Roche ...
-
bioRxiv - Immunology 2021Quote: ... qRT-PCR analysis was performed with PerfeCTa SYBR Green Fastmix (Quantabio) using the following primers from Sigma-Aldrich: S1pr1 (5’-AGCTTTTCCTTGGCTGGAGAG ...
-
bioRxiv - Developmental Biology 2019Quote: The +2.0drl regulatory element was amplified from the zebrafish vector +2.0drl:EGFP by PCR using KOD Hot Start Master Mix (Novagen) (Table S1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and this sequence was amplified by PCR from 3’ RACE cDNA using KOD Hot Start Master Mix (Novagen) with the following primers ...
-
bioRxiv - Developmental Biology 2019Quote: ... marinus genomic DNA or from stl8-26 embryonic cDNA by PCR using KOD Hot Start Master Mix (Novagen). 3’ rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Biochemistry 2019Quote: ... the corresponding genes were amplified by PCR from S.cerevisiae genome and cloned into the plasmid pETDute-1 (Novagen). To construct N-terminal 6×His tagged Ups1-Mdm35 fusion protein ...
-
bioRxiv - Biophysics 2019Quote: ... Mutagenesis was a carried out by a single PCR reaction using the KOD Hot Start DNA polymerase (Novagen) and appropriate mutagenic oligonucleotides (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... BamHI- and HindIII-digested FUBI or ubiquitin PCR fragments were cloned into a modified pET-28b(+) vector (Novagen) allowing for expression of a His6-tagged fusion protein with EGFP that was cloned into the HindIII and XhoI sites ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products of control and sort2 were concentrated by using Amicon Ultra-0.5 10K (UFC501096, Merck Millipore), and analyzed by pair-end sequencing using NovaSeq 6000 system (Illumina) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We used a high fidelity Taq DNA polymerase for DNA amplification (Expand High Fidelity PCR system from Sigma). After that ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was diluted 30-fold and 2.5µl was used to perform Quantitative PCR using Kapa SYBR fast Low-Rox (Sigma) in a final reaction volume of 7.5µl on a QuantStudio 5 384 PCR machine (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... pH 8.0 to a final concentration of 0.2nM and PCR amplified for cloning into T7 phage vector arms (Novagen/EMD Millipore Inc ...
-
bioRxiv - Cancer Biology 2022Quote: The integrated gRNAs were sequenced by the following primers using the Expand High Fidelity PCR system (Sigma-Aldrich): GeCKO 1717F 5′-GAGGGCCTATTTCCCATGAT-3′ and GeCKO 3913R 5′- CGGTGCCACTTTTTCAAGTT -3′ ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR fragments with appropriate restriction sites was cloned into the BamHI and SalI sites of pET28a (Novagen) and pGST4CS ...
-
bioRxiv - Plant Biology 2022Quote: The full-length coding sequence of GGP1 was amplified by PCR and cloned into the pET28a vector (Novagen). The GGP1 enzyme was expressed in E ...