Labshake search
Citations for Millipore Sigma :
351 - 400 of 2489 citations for Rat ZFP90 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The lentivirus plasmid vector pLKO 1-YFP was obtained from Sigma’s validated genome-wide TRC shRNA libraries (Sigma-Aldrich) and was further changed to eGFP in-house.
-
bioRxiv - Cancer Biology 2019Quote: ... NRF2 targeting pLKO shRNA expression were obtained from Sigma (shNRF2#1 ...
-
bioRxiv - Cell Biology 2020Quote: ... or shRNA directed against human IP6K1 (TRC0000013508, Sigma-Aldrich) were co-transfected with VSV-G and psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2019Quote: ... and nontargeting shRNA control were obtained from Sigma Aldrich in the pLKO vector ...
-
bioRxiv - Cancer Biology 2019Quote: ... The shRNA control was purchased from Sigma-Aldrich (#SHC002). pLX317-NRF2 and pLX317-NRF2T80K were obtained from Dr ...
-
bioRxiv - Cell Biology 2019Quote: ... Control and Vav1 shRNA constructs were obtained from Sigma. The HIF-1α construct was obtained from Addgene (Watertown ...
-
bioRxiv - Molecular Biology 2020Quote: shRNAs and siRNA duplexes were obtained from Sigma-Aldrich, Dharmacon or Qiagen (Table 8 ...
-
bioRxiv - Cancer Biology 2021Quote: Validated MISSION® short-hairpin RNAs (shRNAs) (Sigma-Aldrich) were used for knockdown of mouse Setdb1 ...
-
bioRxiv - Microbiology 2021Quote: ... or sirt6 shRNA expression vector (pLKO.1; Sigma-Aldrich) were produced by transfection of HEK293FT cells with indicated plasmids and lentiviral packaging plasmid mix ...
-
bioRxiv - Cancer Biology 2022Quote: ... The shRNA construct used was PTN KD (TRCN0000071677, Sigma). For a negative control ...
-
bioRxiv - Cancer Biology 2022Quote: STAT3 was depleted using the shRNA construct (Millipore Sigma): Gene ...
-
bioRxiv - Cancer Biology 2022Quote: MEN1 was depleted using the shRNA construct (Millipore Sigma): Gene ...
-
bioRxiv - Cell Biology 2021Quote: ... were infected with customized AmotL2 shRNA Lentiviral particles (Sigma) or scrambled shRNA control virus in complete endothelial cell medium with 5 μg/mL polybrene (Vector Builder) ...
-
bioRxiv - Cancer Biology 2020Quote: shRNAs targeting YAP and UGP2 were purchased from Sigma. The shRNA constructs were packaged as lentiviruses using third generation packaging systems with standard protocols ...
-
bioRxiv - Cell Biology 2020Quote: BBS10 shRNA lentivirus particles were purchased from Sigma (St.Louis). The sequences of the two shRNAs selected were ...
-
bioRxiv - Cell Biology 2021Quote: ... shRNAs against human CDCP1 (TRCN0000134829 and TRCN0000137203, Sigma-Aldrich) and MMP17 (TRCN0000049976 and TRCN0000049977 ...
-
bioRxiv - Cancer Biology 2022Quote: GLI2 was depleted using the shRNA construct (Millipore Sigma): Gene ...
-
bioRxiv - Cell Biology 2022Quote: ... Knockdown of PITPNA by MISSION shRNA vectors (Sigma-Aldrich) was confirmed in human pancreatic 1.1B4 cells and isolated islets ...
-
bioRxiv - Cancer Biology 2023Quote: Short hairpin RNA (shRNA) constructs were obtained from Sigma’s MISSION library (Kindly provided by Department of Molecular Cell Biology ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shBRD4-S (#TRCN0000349782, Mission shRNA, Sigma-Aldrich Inc.) along with 30 µl of Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: Short hairpin RNA (shRNA) constructs were obtained from Sigma’s MISSION library (kindly provided by Department of Molecular Cell Biology ...
-
bioRxiv - Genetics 2023Quote: ... scrambled (NT) shRNA (5’-GCGATAGCGCTAATAATTT-3’ SHC202; Sigma-Aldrich) or a shRNA specific for human SOX11 (100% identity to the equine SOX11 sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... with scrambled control or GCN5L1 shRNA (Sigma-Aldrich, USA), or control or GCN5L1 ORF lentiviral particles (Origene ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dock7 shRNAs and negative control were purchased from Sigma (shRNA1 ...
-
bioRxiv - Neuroscience 2023Quote: All shRNAs were designed and produced by Sigma-Aldrich via custom submitted sequences against wildtype NRXN1ɑ (constitutively expressed exon 9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... we used the MISSION® Lentiviral shRNA (Sigma Aldrich/Merck ...
-
bioRxiv - Cancer Biology 2024Quote: ... Short-hairpin RNA (shRNA) constructs were obtained from Sigma (TRCN0000303918 ...
-
bioRxiv - Cancer Biology 2024Quote: ... CTNNB1 and CTNNA1 shRNA vectors were from Sigma-Aldrich.
-
bioRxiv - Cancer Biology 2022Quote: ... MDA-468 cells were also modified with lentiviral vectors to stably express shRNA to LMNA and (MISSION anti-LMNA shRNA, available through Sigma, TRCN0000061835, NM_170707.1-752s1c1) or control non-target MISSION control shRNA (available through Sigma) ...
-
Phospholipase C β4 promotes RANKL-dependent osteoclastogenesis by interacting with MKK3 and p38 MAPKbioRxiv - Cell Biology 2024Quote: The lentiviral constructs containing PLCβ4 small hairpin RNA (shRNA) or a non-specific shRNA control (Con-sh) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Lentiviral particles were generated by transfecting 293T cells with the expression constructs ...
-
bioRxiv - Microbiology 2020Quote: ... Lentivirus expressing shRNAs targeting mouse Irf7 transcripts (Irf7 shRNA1, Sigma TRCN0000077292 and Irf7 shRNA2 ...
-
bioRxiv - Cell Biology 2020Quote: ... and target sequences were based Mission shRNA database (Sigma-Aldrich). RNAi target sequences used in this research include:
-
bioRxiv - Neuroscience 2019Quote: ... the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich, Ref. #TRCN0000012392) or the shRNA control (dsRed2 ...
-
bioRxiv - Physiology 2019Quote: ... pLKO.1 Sirt4 shRNA (TRC0000018948) was purchased from Sigma Aldrich. SIRT4 was cloned into pAdtrack CMV plasmid ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragments encoding shRNAs directed against human CDH13 mRNA (Sigma) were cloned into the pTRIPΔU3-EF1α-EGFP lentiviral vector ...
-
bioRxiv - Neuroscience 2021Quote: ... we used pLKO.1-puro Mission shRNA vectors (Sigma-Aldrich). Target sequences are provided in Table S7 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 µg pLKO.1-shARID1A (MISSION shRNA (Sigma-Aldrich), (TRCN0000059090 or TRCN0000059089 ...
-
bioRxiv - Cancer Biology 2020Quote: ... MISSION shRNA constructs (TRCN0000236186 and TRCN0000236187) were purchased from Sigma and lentiviral partilces were generated in HEK293T cells by contransfecting shRNA plasmid construct with pMD2.G (Addgene#12259 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were transduced with ready-made Mission shRNA lentiviral particles (Sigma) expressing four different LBH-specific shRNAs (TRCN0000107525-shLBH#1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and non-targeting shRNA control were obtained from Sigma-Aldrich in the pLKO vector and were prepared as previously described 15 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or control non-target MISSION control shRNA (available through Sigma). MDA-231 and BT-549 cells were modified with NLS-RFP (pCDH-CMV-3xNLS-TagRFP-T-EF1-blastiSBT-549 [30] ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were infected with MISSION® shRNA lentiviruses (Sigma-Aldrich) designed for the human PRKCA gene (TRCN0000196730 ...
-
bioRxiv - Cancer Biology 2022Quote: shRNA targeting murine Map3k7 was purchased from Sigma-Aldrich (TRCN0000022563). A pLKO.1-puro Non-Target shRNA was used as control ...
-
bioRxiv - Cancer Biology 2020Quote: Four different mission shRNAs from the TRC1 library (Sigma-Aldrich, TRCN0000019174 ...
-
bioRxiv - Microbiology 2022Quote: NOD2 MISSION shRNA Lentiviral Transduction Particles from Sigma Aldrich (TRCN0000066813) were used to stably down-regulate NOD2 in J774 macrophage ...
-
bioRxiv - Cancer Biology 2022Quote: ... pCMV-VSV-G and shRNA-encoding lentiviral vectors (Sigma-Aldrich) into HEK293T cells with Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA and shRNA expression were induced by Doxycycline (Sigma, D9891) at concentrations ranging from 0.1 to 1.0 μg/mL ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral constructs expressing shRNAs directed against SLFN11 (Sigma TRCN, TRCN0000152057) or a non-targeting control shRNA (TRCN0000231489 ...
-
bioRxiv - Cell Biology 2021Quote: ... The shRNA-containing lentiviral vectors were purchased from Sigma Aldrich.
-
bioRxiv - Microbiology 2022Quote: ... shRNA is in TRC2-pLKO-puro vector (SHC201 Sigma-Aldrich) background with puromycin as a mammalian selection marker ...