Labshake search
Citations for Millipore Sigma :
201 - 250 of 2489 citations for Rat ZFP90 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: PDA530Met cells were transduced with control Scr shRNA (Non-Mammalian shRNA Control, SHC002, Sigma-Aldrich) or two independent shRNAs directed against the target gene ...
-
bioRxiv - Cell Biology 2023Quote: ... The following shRNAs were used in this study: Non-Targeting shRNA Controls (Sigma, Cat. # SHC002), shZNF598#1 (Sigma ...
-
bioRxiv - Evolutionary Biology 2021Quote: The HIV-derived lentiviral vector pLKO.1 containing shRNAs (TRIM17 MISSION shRNA Bacterial Glycerol Stock, Sigma) that targeted Trim17 (shTrim17-1 ...
-
bioRxiv - Cell Biology 2021Quote: Control or Myo10 shRNA knockdown C2C12 lines were made using MISSION shRNA lentiviral particles (Sigma-Aldrich No ...
-
bioRxiv - Cell Biology 2021Quote: ... 4EBP1 shRNA (TRCN0000335449) and EIF4G1 shRNA (TRCN0000096812) targeting the Coding Sequence (CDS) were all from Sigma. Lentiviral backbone pLV-EF1a-IRES-Neo was a gift from Tobias Meyer (Addgene plasmid #85139) ...
-
bioRxiv - Cancer Biology 2020Quote: We generated lentiviral shRNA particles for silencing mouse EphB4 (MISSION shRNA; Sigma-Aldrich TRCN0000023619 and TRCN0000023621); SHP2 (MISSION shRNA ...
-
bioRxiv - Immunology 2021Quote: shRNA clones were obtained from the whole RNAi human library for shRNA mediating silencing (Sigma, Aldrich) maintained at IISER ...
-
bioRxiv - Neuroscience 2022Quote: ... we used the previously characterized Lmx1a-targeting shRNA construct (pLKO. 1-mouse Lmx1a shRNA, Sigma, TRCN0000433282) (Fregoso et al. ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA constructs targeting METTL3 and control shRNA in the pLKO.1 vector were procured from Sigma. To generate lentiviral particles for each shMETTL3 and control shRNA construct ...
-
bioRxiv - Neuroscience 2020Quote: ... Mission ShRNA bacterial Glycerol stock NM_026582) and scramble control (Mission TRC2 PlkO.5-PURO Non-Mammalian shRNA control Plasmid) were purchased from Sigma-Aldrich. Wnt3a plasmid pLCN-Wnt3a-HA (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: ... HEK293T were plated at 50% confluency on 60 mm dishes and transiently transfected with the gene specific shRNA pLKO.1 plasmid (Sigma), packaging plasmid (Δ8.9 ...
-
Cell culture dimensionality influences mesenchymal stem cell fate through cadherin-2 and cadherin-11bioRxiv - Cell Biology 2019Quote: pLKO.1 plasmids containing short hairpin RNA (shRNA) sequences targeting cadherin-11 or cadherin-2 were obtained from Sigma-Aldrich together with a scrambled negative control ...
-
bioRxiv - Cancer Biology 2020Quote: ... lentiviral vectors expressing the shRNA targeting PAT4 were produced as follows: HEK293T cells were co-transfected with shRNA-PAT4 plasmid DNA (5’-CCGGCCTTGATAAATGAGCAGAATTCTCGAGAATTCTGCTCATTTATCAAGGTTT TTG-3’; TRCN0000043984; Sigma) or new shRNA lentivirus (GTTGTCCTTATTGGAGATTC ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral-mediated shRNA knockdown was carried out as described previously (Cui et al., 2012) with plasmids encoding shRNA against RanBP2 (shRNA1: TRCN0000003452, shRNA3: TRCN0000003454, Sigma), AGO1 (shRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Viral vectors for shRNA expression as well as empty-cassette plasmids used as vector controls were obtained from the Mission TRC library (Sigma) via the McGill Platform for Cellular Perturbation (clone information and sequences in Supplementary Table 2) ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were transfected with 0.5 µg/well of pLKO.1-puro Vector empty or with plasmids containing the target shRNA sequence for the indicated kinases (Mission Library, Sigma). 48h after transfection ...
-
bioRxiv - Cell Biology 2020Quote: Silencing of MASTL and TSC2 was performed using pLKO.1 lentiviral plasmids encoding specific siRNA (ON-TARGET SMARTpool, Dharmacon) or shRNA sequences (Sigma), as previously described 59 ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 Fbxo45 shRNA plasmids shFbxo45b (TRCN0000201180, target sequence GACATGGAGGATAAGACTTTA) and shFbxo45a (TRCN0000339817 target sequence TGGAATCTGGTGGACAATAAT) were obtained from Sigma. When co-transfected with Flag-Fbxo45 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T were plated at 50% confluency on 60 mm dishes and transiently transfected with the gene specific shRNA pLKO.1 plasmid (Sigma), packaging plasmid (Δ 8.9 ...
-
bioRxiv - Physiology 2023Quote: Glycerol stocks of pLKO.1-puro lentiviral plasmid vectors containing shRNA targeting human Nup93 (NM_014669) and an empty vector insert (shEmpty) were purchased from Sigma-Aldrich. Lentivirus expressing shNup93 or shEmpty were generated by PEI-mediated co-transfection of pLKO.1-puro ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293T were plated at 40% confluency on 60 mm dishes and transfected with the gene specific shRNA pLKO.1 plasmid (Sigma), packaging plasmid (Δ8.9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293T were plated at 50% confluency on 60 mm dishes and transiently transfected with the gene specific shRNA pLKO.1 plasmid (Sigma), packaging plasmid (Δ8.9 ...
-
bioRxiv - Biophysics 2021Quote: ... A non-targeting shRNA (Sigma SHC216) was used as a control.
-
bioRxiv - Immunology 2021Quote: ... or control shRNAs for GFP (Sigma) and luciferase (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: pLKO1 vector containing shRNA (Sigma Aldrich) and H2b-GFP plasmids (gift from Elaine Fuchs ...
-
bioRxiv - Biochemistry 2019Quote: ... the most effective shRNA (TRCN0000007273; Sigma) for lentiviral infection were used for experiments ...
-
bioRxiv - Cancer Biology 2019Quote: ... pLKO.1-non-targeting shRNA (Sigma; 5’- CCT AAG GTT AAG TCG CCC TCG CTC GAG CGA GGG CGA CTT AAC CTT AGG -3’) ...
-
bioRxiv - Cancer Biology 2020Quote: ... non-mammalian shRNA sequences (Sigma SHC002) were cloned into Tet-pLKO-puro vectors by using oligo (5’-3’) ...
-
bioRxiv - Neuroscience 2020Quote: ... non-targeted shRNA (SHC016, Sigma-Aldrich), or empty vector plko.1 lentivirus ...
-
bioRxiv - Cancer Biology 2021Quote: Mission shRNA vectors purchased from Sigma were transiently transfected along with pCMV-VSVG and ps-PAX2 into HEK 293T cells using polyethylenimine (PEI ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNAs targeting ERF (Sigma-Aldrich: TRCN000001391) and lentiviral GFP-tagged ERF (GeneCopoeia ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1 HIF2α shRNA (#TRCN0000082307, Sigma).
-
bioRxiv - Biochemistry 2020Quote: ... The shRNAs used were from Sigma shRNA clone library which were identified by TRC numbers.
-
bioRxiv - Cancer Biology 2021Quote: ... Vectors encoding for random shRNA (Sigma) were used as a control ...
-
bioRxiv - Immunology 2020Quote: ... and human RNF20-specific shRNA (Sigma, TRCN0000033876 ...
-
bioRxiv - Neuroscience 2021Quote: ... TurboGFP-targeting shRNA (SHC004 Sigma-Aldrich) and a universal non-targeting shRNA (LV015-G ABM ...
-
bioRxiv - Cancer Biology 2020Quote: ... A non-target shRNA (shNT) (Sigma MISSION shRNA non-mammalian control SHC002 ...
-
bioRxiv - Cell Biology 2022Quote: ... LentiCRISPRv2 vector with predesigned shRNA (Sigma mission shRNA TRCN0000312779 ...
-
bioRxiv - Neuroscience 2022Quote: ... Control non-targeting shRNA (Sigma, SHC002), and shRNAs targeting Mmp24 and Pcdhαc2 were obtained from Sigma (Mmp24 shRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control-shRNA (Sigma Cat# SHC016) was generated by co-transfecting the lentiviral plasmids in HEK293T cells with VSV-G (the envelop expressing plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... shGLUT1 (Mission TRC shRNA, TRCN0000043583, Sigma), shIGFR1#1 (Mission shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... shIGFR1#1 (Mission shRNA, TRCN0000039677, Sigma), shIGFR1#2 (Mission TRC shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... ShRNA constructs were obtained from Sigma: shControl (SHC002) ...
-
bioRxiv - Molecular Biology 2023Quote: Commercially available shRNA lentiviral vectors (Sigma, TRCN0000147948 ...
-
bioRxiv - Biochemistry 2023Quote: ... or scramble shRNA (SHC002, Sigma-Aldrich) using Lipofectamine 3000 ...
-
bioRxiv - Cancer Biology 2020Quote: Phf6 shRNA sequences were designed using http://cancan.cshl.edu/RNAi_central/RNAi.cgi?type=shRNA and purchased from Sigma-Aldrich [39] ...
-
bioRxiv - Neuroscience 2020Quote: We purchased a MISSION shRNA vector library encoding the microRNA-adapted shRNA targeting mouse Nwd1 (Sigma-Aldrich). Among five shRNA clones (TRCN0000257630 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 10 µg lentiviral expression constructs shRNA pLKO.1-puro (G9a Mission shRNA, Sigma-Aldrich, TRCN0000115671, NM_025256,); For DDX5 knockdown the custom sequence AACCGCAACCAUUGACGCCAU (Sigma-Aldrich DDX5 Mission shRNA plasmid DNA ...
-
bioRxiv - Immunology 2020Quote: ... Lentiviral constructs encoding a non-targeting shRNA or CYLD-targeting shRNA (SHCLNG-NM_173369) were obtained from Sigma.
-
bioRxiv - Cancer Biology 2021Quote: The lentiviral shRNA clones targeting mouse aldolase A and nontargeting shRNA control were obtained from Sigma Aldrich in the pLKO vector ...