Labshake search
Citations for Millipore Sigma :
151 - 200 of 2489 citations for Rat ZFP90 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ST6GAL1 gene shRNA clone was obtained from MISSION shRNA library (Sigma Merck, USA). Plasmid containing shRNA or scrambled control was packaged into lenti virus using packaging vectors pMD2.G and psPAX2 (packaging vectors were a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentivirus containing small hairpin RNA (shRNA) (Sigma, Mission Human Genome shRNA Library) against the target gene was inoculated in the presence of 8μg/ml polybrene (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: Following pLKO.1 shRNA were used: shINSR#1 (Mission TRC shRNA, TRCN0000010523, Sigma), shINSR#2 (Mission TRC shRNA ...
-
bioRxiv - Cell Biology 2023Quote: Primary MEFs were infected with shRNA using the mouse Endog-directed shRNA (Sigma), Vdac1 ...
-
bioRxiv - Cancer Biology 2021Quote: Forward and reverse oligonucleotides for a MYL9 and MYL12b-targeting shRNA and a nontargeting shRNA construct were designed using The RNAi Consortium collection (MISSION® shRNA, Sigma Aldrich).
-
bioRxiv - Cell Biology 2023Quote: Human EndoC-βH1 and rat INS1E beta cells were cultured as previously described [45] and incubated with lentiviruses expressing an NNAT-targeting shRNA (Sigma-Aldrich) or Silencer Select siRNAs (Ambion) ...
-
bioRxiv - Cancer Biology 2019Quote: In utero electroporation was performed as described previously [1] using the following plasmids: pLKO.1-Cic shRNA (Sigma, TRCN0000304642 ...
-
bioRxiv - Neuroscience 2021Quote: ... Hek293T cells were transfected with packaging and envelope expressing plasmids together with PLKO.1-shRNA control (SHC016, SIGMA) or targeting MPC1 (ShMPC1_1 ...
-
bioRxiv - Pathology 2022Quote: ... The cells were transfected with different types of CYP24A1-specific small-hairpin RNA (shRNA)-expressing lentivirus plasmids (Sigma) using FuGENE6 (Roche ...
-
bioRxiv - Genomics 2023Quote: ... The MEF2B shRNA sequences inserted in a pLKO-1 puro plasmid are listed in Table S4 (Sigma, #SHCLNG).
-
bioRxiv - Biochemistry 2021Quote: ... the shRNA oligos targeting LacZ and mouse Tpi obtained from MISSION shRNA Library (Sigma) were first cloned into their respective entry vectors (pENTR-U6) ...
-
bioRxiv - Cell Biology 2022Quote: All shRNA clones were part of the MISSION shRNA product line from Sigma Aldrich. The TRC1.5 pLKO.1-puro non-Mammalian shRNA Control Plasmid DNA (SHC002 ...
-
bioRxiv - Cancer Biology 2022Quote: Human HEK-293T cells transfected with either LacZ shRNA (control) or IKKα shRNAs (Sigma) along with their corresponding packaging plasmids were used to prepare lentiviruses from cell culture medium 48 h after transfection ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were transduced with lentivirus encoding shRNA targeting against human SLC25A51 (Sigma, Mission shRNA). shRNA sequences used are ...
-
bioRxiv - Cancer Biology 2022Quote: ... the following short hairpin RNA (shRNA) constructs from the Mission TRC shRNA library (Sigma) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences for shRNAs were identified through the MISSION® Predesigned shRNA libraries (Sigma-Aldrich) and shRNAs were obtained from the La Jolla Institute for Immunology RNAi Center (La Jolla ...
-
bioRxiv - Systems Biology 2024Quote: Lentiviruses containing shRNA hairpins were purchased from the MISSION® shRNA Lentiviral library (Sigma) (Supplementary Table 4.1) ...
-
bioRxiv - Cell Biology 2023Quote: ... using commercially available lentiviral vectors encoding the desired shRNAs (MISSION® shRNA, Sigma-Aldrich; shSUN1 - TRCN0000133901 - Target Sequence ...
-
bioRxiv - Cancer Biology 2021Quote: ... PFKFB3 shRNAs were from Sigma shRNA library (sh1 ...
-
bioRxiv - Immunology 2021Quote: ... pLKO1 shRNA (SHC016V, Sigma-Aldrich) was used as a control.
-
bioRxiv - Molecular Biology 2019Quote: ... and nontarget shRNA (Sigma, SHC002). Lentiviral vectors were packaged into the virus by the UCSF RNAi Core ...
-
bioRxiv - Biochemistry 2021Quote: ... pLKO.1-Evl shRNA (Sigma TRCN0000091075 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or control shRNA (Sigma, #SHC216V). Infected cells were selected by Puromycin (2 μg/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... NBS1 (Sigma mission shRNA TRCN0000288622) or a non-targeting control (obtained through (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... were obtained from Sigma Mission shRNA library (Sigma-Aldrich). Immortalized Smarcb1f/f preadipocytes were infected with lentiviral shRNA targeting Arid1a or control virus alone for 24h ...
-
bioRxiv - Cell Biology 2020Quote: ... A shRNA scramble (SHC002, Sigma) was used as a control ...
-
bioRxiv - Cell Biology 2019Quote: The shRNAs targeting USP7 (Sigma), EZH2 ...
-
bioRxiv - Neuroscience 2019Quote: ... or scramble shRNA (Sigma, SHC202). For Bru-seq experiments ...
-
bioRxiv - Molecular Biology 2019Quote: Lentiviruses expressing shRNAs (Sigma-Aldrich Mission mouse or human Lentiviral shRNA libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... SHP2 (MISSION shRNA; Millipore-Sigma, TRCN0000327987 ...
-
bioRxiv - Immunology 2020Quote: ... human CtIP-specific shRNA (Sigma, TRCN0000318738 ...
-
bioRxiv - Cell Biology 2022Quote: ... and GAN shRNA (Sigma, TRCN0000083861) respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... Pink1-shRNA (Sigma Cat# TRCN0000199446) and Control-shRNA (Sigma Cat# SHC016 ...
-
bioRxiv - Developmental Biology 2024Quote: ... shRNAs were bought from Sigma’s Mission Library (TRCN0000263127 and TRCN0000282500) ...
-
bioRxiv - Neuroscience 2024Quote: ... or MARK3 shRNA (Sigma, TRCN0000001564) were packaged into lentivirus by VectorBuilder ...
-
bioRxiv - Cancer Biology 2022Quote: ... and non-targeting control shRNA (pLKO.1-puro non-Target shRNA Control; referred to as shCtrl) were obtained from Sigma (MISSION® shRNA Library), amplified ...
-
bioRxiv - Cancer Biology 2020Quote: ... two short hairpin RNAs (shRNA) targeting SLX4IP in the pLKO.1-puro lentiviral expression plasmid were purchased from Sigma (Clone ID NM_001009608.1-426s1c1 and NM_001009608.1-247s1c1) ...
-
bioRxiv - Microbiology 2020Quote: ... MDMs were transfected with plasmids that encoded either a mixture of three to five shRNAs directed against IRF8 (Sigma) or a mixture of control shRNAs (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... The total RNA was isolated from the hepatic cells grown after successful transfection of the plasmids containing shRNA molecules against both target genes as per the manufacturer’s protocol using Trizol (Sigma). The RNA samples were treated with DNase I (Fermentas ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg of Endonuclease G shRNA plasmid was transfected using linear/branched PEI (Polyethylenimine) polymer (Sigma, 1 mg/ml) (Longo et al. ...
-
bioRxiv - Cell Biology 2022Quote: Transfer plasmids with pre-designed shRNA against human Cdc42 mRNA were obtained from the Mission® TRC library (Sigma). Specifically ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-puro shRNA plasmid DNA was isolated from bacteria glycerol stocks (IFNAR1: TRCN0000301483, PD-L1: TRCN0000068001; Sigma Aldrich) using E.Z.N.A.® Plasmid Mini Kit I (Omega Bio-tek ...
-
bioRxiv - Immunology 2023Quote: Protein expression was stably knocked down in Jurkat T cells by RNA interference using Mission shRNA plasmids (Sigma-Aldrich). Lentiviral particles were generated by transfecting HEK293T cells with pMD2G ...
-
bioRxiv - Cancer Biology 2024Quote: The shRNA plasmid (pLKO.1) for TP53 (TRCN0000003754) and TRIM28 (TRCN0000017998) were obtained from the TRC library (Sigma, IISc). The TRIM28 3’ UTR Luc vector plasmid was purchased from Origen ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5μg lentiviral expression constructs shRNA (pLKO.1 Mission shRNA DNA clone, Sigma-Aldrich Inc.) or shMCU (#SHCLNG-NM_138357 Mission shRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... non-target shRNA (SHC002) and eIF4E shRNA (SHCLND-NM_001968) and were purchased from Sigma Aldrich. shRNA to human raptor (plasmid#1857) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stable lentiviral vectors expressing shRNA targeting MSI2 and control shRNAs were obtained from Sigma Aldrich (Mission lentiviral system ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentiviral shRNA clones targeting Mapk6 and Makpakp5 were from the TRC1 shRNA library (Sigma-Aldrich): TRCN0000023199 for Mapk6 and TRCN0000024197 for Makpakp5 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lamin B1 shRNA was expressed from pLKO.1 shRNA-LMNB1.71 puro (SHCLND-NM_005573, Sigma-Aldrich) containing the sequence ...
-
bioRxiv - Neuroscience 2022Quote: ... Silencing constructs encoding control shRNA and mfn2 shRNA (target sequence: TGGATGGACTATGCTAGTGAA) were purchased from Sigma (SHC202 and TRCN0000080612 respectively) ...