Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for 6 Phenyl hexa 3 5 dien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... Inflorescences of each GUS line were pre-treated with ice cold acetone for 1h at −20°C and washed two times for 5 minutes with 100 mM sodium phosphate buffer followed by one wash with sodium phosphate buffer containing 1 mM K3Fe(CN)6 and 1 mM K4Fe(CN)6 (both Sigma) at room temperature ...
-
bioRxiv - Plant Biology 2021Quote: ... One mL of 2 M TFA stock (Sigma, USA) was added to the methanolic HCl-treated walls and incubated for 1 h at 120°C ...
-
bioRxiv - Neuroscience 2020Quote: ... One intravenous injection of dextran-FITC (Sigma, 2 MD) diluted in 0.9 % saline is provided as the vascular contrast agent for fluorescent imaging.
-
bioRxiv - Neuroscience 2023Quote: ... iii) one bottle of saccharine solution (2%, Sigma Aldrich) and one bottle of nicotine (100 µg/ml free base ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μg/mL 4′,6-Diamidin-2-phenylindol (DAPI, Sigma-Aldrich) in 1X PBS was added for 2 min followed by a final washing step ...
-
bioRxiv - Biochemistry 2022Quote: ... pLANT-2/RIL–RFC[1+5] was co-transformed with pET(11a)-RFC[2+3+4] into BLR(DE3) cells (Novagen, Madison, Wisconsin). The cell lysate was clarified by centrifugation ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Cancer Biology 2019Quote: HBP inhibition in vivo was achieved by treatment of tumor bearing mice with 3 doses (10 mg/kg) of DON (6-Diazo-5-oxo-L-norleucine, Sigma-Aldrich) every 3 days ...
-
bioRxiv - Biophysics 2021Quote: ... 5(6)-Carboxyfluorescein was purchased from Sigma-Aldrich. Methyl-α-cyclodextrin (MαCD ...
-
bioRxiv - Microbiology 2021Quote: ... 6 mM MnCl2 (Sigma-Aldrich, 7773-01-5), 0.7 mM dNTPs with 10 U SuperScript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... and 5 U glucose 6-phospahte dehydrogenase (Sigma).
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM EDTA (Sigma-Aldrich, 6381-92-6) and protease and phosphatase inhibitors (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... lapachol (2-hydroxy-3-(3-methyl-2-butenyl)-1,4-naphthoquinone) were purchased from Sigma-Aldrich. Vismione H and madagascine were obtained from PGE2 fraction of Psorospermum glaberimum as previously described (Gallé ...
-
bioRxiv - Molecular Biology 2020Quote: ... the ERS alleviator 4-phenyl butyric acid (4-PBA, 5 mM) and the ATF6 inhibitor Ceapin-A7 (500 nM) were purchased from Sigma-Aldrich. Chondrocytes were cultured in DMEM supplemented with Tm or Tg for 6 h ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Cell Biology 2022Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
bioRxiv - Cell Biology 2020Quote: ... blocked for one hour with 5% skim milk (Sigma 70166) in PBST and overnight incubated with primary antibodies diluted in 5% BSA (Sigma A2153 ...
-
Proteasome granular localization is regulated through mitochondrial respiration and kinase signalingbioRxiv - Cell Biology 2022Quote: ... and 2-[2-(3-chlorophenyl)hydrazinylidene]-propanedinitrile (CCCP) (Sigma), were used at final concentrations of 0.5 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-[2-(3-chlorophenyl)hydrazinylyidene]propanedinitrile (CCCP) (Sigma-Aldrich), rhodamine 123 ...
-
bioRxiv - Cancer Biology 2021Quote: ... mice were randomized in two groups of which one received henceforth 2 mg/ml DOX (BelaDox, Bela-pharm) dissolved in drinking water containing 5% sucrose (Sigma-Aldrich) to induce TCF7L1 re-expression (DOX (+)) ...
-
bioRxiv - Cancer Biology 2019Quote: ... mice were randomized in two groups of which one henceforth was treated with 2 mg/ml BelaDox (Bela-pharm, Germany) dissolved in drinking water containing 5% sucrose (Sigma-Aldrich) to induce an in vivo knockdown (Dox (+)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... mice were randomized in two groups of which one received henceforth 2 mg/ml Dox (BelaDox, Bela-pharm) dissolved in drinking water containing 5% sucrose (Sigma-Aldrich) to induce sh4E-BP1_2 expression ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2-4 months old mice were orally gavaged with 3 x 2 (Mist1creERT/+KRASG12D/+) or 5 x 5 mg (Ptf1acreERT/+KRASG12D/+) of tamoxifen (TX; Sigma-Aldrich, T5648-5G) at Western University and 5 x 4 mg (Ela-creERT ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910), ATP (Sigma-Aldrich A2383) ...
-
bioRxiv - Microbiology 2022Quote: ... the msfGFP levels were normalized for OD600 and converted to absolute units using 5(6)-carboxyfluorescein (5(6)-FAM) (Sigma Aldrich) as a calibrant (36 ...
-
bioRxiv - Microbiology 2023Quote: ... The relative msfGFP measurements were normalised for their respective OD600 values and subsequently converted to absolute units of the calibrant 5(6)-carboxyfluorescein (5(6)-FAM)) (Sigma-Aldrich). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant Py-S2 proteins fused to hexa-histidine tag were expressed in Rossetta2 (DE3) (EMD Millipore/Novagen) and purified with hexa-histidine affinity resin (Talon beads from Takara/Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant Py-S2 proteins fused to hexa-histidine tag were expressed in Rossetta2 (DE3) (EMD Millipore/Novagen) and purified with hexa-histidine affinity resin (Talon beads from Takara/Clontech) ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant Py-S2 proteins fused to hexa-histidine tag were expressed in Rossetta2 (DE3) (EMD Millipore/Novagen) and purified with hexa-histidine affinity resin (Talon beads from Takara/Clontech) ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant Py-S2 proteins fused to hexa-histidine tag were expressed in Rossetta2 (DE3) (EMD Millipore/Novagen) and purified with hexa-histidine affinity resin (Talon beads from Takara/Clontech) ...