Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 6 Phenyl hexa 3 5 dien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... phosphatase inhibitors 2 and 3 (Sigma) and protease inhibitor cocktail (Complete ...
-
bioRxiv - Bioengineering 2021Quote: ... The secondary antibodies were washed away with PBS (3x 5 min) whereafter 4’,6-diamidino-2-phenylindole (DAPI, 1:500, Sigma) was added for 10 minutes to localize the cell nuclei ...
-
bioRxiv - Neuroscience 2021Quote: ... saline or 6-OHDA (5 μg/μL; 2 μL in total, at a rate of 0.5 μL/min, Sigma, Canada) were injected unilaterally in the dorsal striatum ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclear labelling was achieved by incubating the sections for 5 min in DAPI (4′,6-diamidino-2-phenylindole; 1:5000; Sigma). Two final washes in PBS were performed before the sections were mounted on glass slides using Vectashield (Vector Laboratories ...
-
bioRxiv - Genomics 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (5 μM) and propidium iodide (PI) (50 μg/mL) (Sigma-Aldrich, St. Louis, USA) and incubated at room temperature for 30-60 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were washed three times in PBS and mounted in 70% glycerol with with 5 μgml-1 concentration of 4-6-diamidino-2-phenylindole (DAPI, Sigma) and cells were mounted on cover slips ...
-
bioRxiv - Neuroscience 2019Quote: ... 5, 6 and 7 (days 52 to 55 in the overall timeline, Figure 2) at 100 mg/kg ip (Sigma), at approximately 17:00 hr ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were washed three times with 1x PBS and incubated for 5 minutes in 300 nM 4′,6-diamidino-2-phenylindole (Sigma) before a final 1x PBS wash ...
-
bioRxiv - Immunology 2020Quote: ... Cells were washed once with PBS prior incubation for 5 min at 37 °C with 4′,6-diamidino-2-phenylindole (DAPI; Sigma). Finally ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Chromosomes were stained with 4′,6-diamidino-2-phenylindole at a concentration of 5 μg/ml (DAPI; Sigma-Aldrich, D8417).
-
bioRxiv - Immunology 2024Quote: ... slides were washed in PBS and incubated in 5 μg mL-1 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... The full length coding sequence of AdACS1/2/3 and AdACO3/5 were inserted into pET-32a (Novagen) vector and then transferred into Escherichia coli strain BL21 (DE3) ...
-
bioRxiv - Neuroscience 2022Quote: ... we delivered the Iκ-kinase inhibitor [5-(p-Fluorophenyl)-2-ureido]thiophene-3-carboxamide (TPCA-1; Sigma-Aldrich CAS 507475-17-4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Larvae were incubated overnight from 4 dpf in 3 ml 10 mM 5-Bromo-2′-deoxyuridine (B5002, Sigma) with 1% DMSO for 17 hours ...
-
bioRxiv - Microbiology 2023Quote: ... After 24 hrs media/inhibitor was aspirated and replaced with 20 μl of 5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) (Sigma) and incubated at 37 °C in 5% CO2 for 3 hrs ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μL MTT (5 mg/ml tetrazolium salt 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, Sigma-Aldrich) was added to each well and kept in a dark for 4 hours at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Plant Biology 2019Quote: ... and 0.5 mg/mL 5(6)-Carboxyfluorescein diacetate (Sigma) was applied to the cut using a P2 pipette ...
-
bioRxiv - Biophysics 2021Quote: ... and 5(6)-carboxyfluorescein were purchased from Sigma-Aldrich. Methanol (LC/MS grade ...
-
bioRxiv - Biochemistry 2021Quote: ... G6PD (1M 6-aminonicotinamide, Sigma, Cat#329-89-5), PKM (20μM Compound 3K ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μM 6-azauridine (catalogue no. A1888; Sigma-Aldrich), 5 μM HCQ (catalogue no ...
-
bioRxiv - Genomics 2020Quote: ... We followed the protocol as described previously [6] with one alteration: instead of using one paperdisc (Whatman qualitative filter paper, WHA1001070, SIGMA-ALDRICH CO LTD) per extraction ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 3-MA (M9281, Sigma), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Neuroscience 2021Quote: ... one PBS wash for 5’ and embedded in Fluorsave (Millipore, 2848323).
-
bioRxiv - Cell Biology 2022Quote: ... Hexa KO cells were treated with the retrovirus containing medium and 8 μg/mL polybrene (Sigma-Aldrich, H9268). After 2 days ...
-
bioRxiv - Developmental Biology 2021Quote: Larvae at 2-6 dpf were first anesthetized with 0.03 % Ethyl 3-aminobenzoate methane sulfonate salt (Sigma-Aldrich, St. Louis, MO, USA) and pinned onto a Sylgard-filled recording chamber (I-2450 ...
-
bioRxiv - Neuroscience 2020Quote: ... one containing 20% ethanol adulterated with 100 μM (Days 1 and 2) or 250 μM (Day 3) quinine hemisulfate (Sigma-Aldrich, St. Louis, MO) and the other containing water ...
-
bioRxiv - Developmental Biology 2021Quote: ... Endogenous pigmentation was inhibited from 24 hpf by the addition of 0.003% 1-phenyl-2-thiourea (PTU, Sigma-Aldrich, St. Louis, MO) to E3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos fixed after 24 hpf were incubated in 0.003% 1-phenyl-2-thiourea (PTU) (Sigma-Aldrich, Milwaukee, WI, USA Cat# P7629-100G) at 24 hpf until the time of fixation ...
-
bioRxiv - Developmental Biology 2019Quote: ... the embryos used for WISH or confocal analysis were cultured in fish water containing 0.003% 1-phenyl-2-thiouera (PTU, Sigma-Aldrich, cat. # P7629) from 24hpf on ...
-
bioRxiv - Systems Biology 2021Quote: Embryos which were to be used in immunofluorescence experiments were grown in egg water supplemented with 0.003% 1-phenyl 2-thiourea (PTU) (Sigma-Aldrich, Cat# P7629) from 24 hpf to prevent pigmentation ...
-
bioRxiv - Genetics 2023Quote: ... The resulting F2 embryos were collected and raised in embryo media (E3) that contained 200 μM 1-phenyl 2-thiourea (PTU; Sigma Aldrich #P7629) to inhibit pigmentation28 ...
-
bioRxiv - Plant Biology 2021Quote: ... medium, containing 3% sucrose, 10−6 M potassium indole acetate (Nacalai Tesque, Kyoto, Japan) and 10−5 M kinetin (Sigma, St. Louis, MO) at 25 °C ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5% 2-mercaptoethanl (Sigma) by incubating the beads at 100°C for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 5% 2-mercaptoethanol (Sigma) and fractionated by SDS-PAGE using the Mini-PROTEAN Tetra System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol (Sigma), and incubated at room temperature instead of boiled ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...