Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for 6 Phenyl hexa 3 5 dien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma). Flow cytometry was performed on a MACSQuant Analyzer 10 (Miltenyi Biotec) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma). Slides were mounted with Elvanol mounting medium.
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamino-2-phenylindole (DAPI) (Sigma) in PBS for 5 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma) or fixable viability dye 405 (eBiosciences) ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; 5 µg/ml, Sigma-Aldrich) at room temperature for 20 minutes.
-
bioRxiv - Neuroscience 2022Quote: ... Sections were mounted after 4′,6-diamidino-2-phenylindole (DAPI) staining (1:5 000, Sigma-Aldrich, USA). Confocal images were captured under 20× objective using A-1R Confocal Microscope (Nikon ...
-
bioRxiv - Developmental Biology 2022Quote: ... and (+−)-6-hydroxy-2,5,7,8- tetra- methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Potassium chloride (cat ...
-
bioRxiv - Cell Biology 2023Quote: ... the DNA was stained with 5 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, D9542-5MG, SIGMA) diluted in 2% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... and (+−)-6-hydroxy-2,5,7,8-tetra-methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Sodium hydroxide (cat ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... and (+−)-6-hydroxy-2,5,7,8-tetra-methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. 1× Phosphate Buffered Saline (PBS ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Bioengineering 2023Quote: ... and lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP, Sigma-Aldrich) for GelMA ...
-
bioRxiv - Neuroscience 2019Quote: ... after which 10 μM 6-TG (6-thioguanine or 2- amino-6-mercaptopurine, Sigma-Aldrich) with 200 μg/ml G418 selection was carried out for an additional 6-8 days ...
-
bioRxiv - Cell Biology 2019Quote: ... Some PAs were treated with XE991 (3·10-8-3·10-6, Sigma) before the stimulation with 5-HT and then the relaxation induced by SNP was tested.
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... one gastrocnemius were mounted in tragacanth gum (6% in water; Sigma-Aldrich), and frozen in isopentane precooled in liquid nitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... 5(6)-carboxyfluorescein (CF) was from Sigma. EM104 10ml glass syringes from Sanitex international.
-
bioRxiv - Cell Biology 2022Quote: ... rinsed in PBS and incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) at RT for 30min ...
-
bioRxiv - Microbiology 2024Quote: ... and methyl N-[2-[[1-(4-chlorophenyl)pyrazol-3-yl]oxymethyl]phenyl]-N-methoxycarbamate (i. e. pyraclostrobin, pesticide analytical standard, CAS 175013-18-0, supplier: Sigma-Aldrich, purity ≥ 98.0% ...
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μl of 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT, 0.5 mg/ml in PBS, Sigma-Aldrich, USA) with 1 μM of menadione (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... transgenic and mutant zebrafish embryos were raised at 28°C in Embryo Water (Volvic© water containing 0.28 mg/mL Methylene Blue [M-4159; Sigma] and 0.03 mg/mL 1- phenyl-2-thiourea [P-7629; Sigma]), and staged according to Westerfield (Westerfield ...
-
bioRxiv - Developmental Biology 2019Quote: ... They were incubated at 28.5°C in 0.3% Danieau medium supplemented 5h after birth with 0.003% (wt/vol) 1-phenyl-2-thiourea (PTU) (Sigma Aldrich) to inhibit pigment formation ...
-
bioRxiv - Cell Biology 2019Quote: Larvae used for imaging were maintained in embryo media containing 0.003% 1-phenyl 2-thiourea (PTU, Sigma-Aldrich P7629) starting at 20 hours post-fertilization ...
-
bioRxiv - Neuroscience 2021Quote: ... containing either 0.01% methylene blue to suppress fungal growth and/or 0.2 mM PTU (1-phenyl-2-thiourea; Sigma-Aldrich) to prevent pigment development ...
-
bioRxiv - Neuroscience 2020Quote: (T-4)-[(1E,6E)-1,7-Bis[4-(dimethylamino)phenyl]-1,6-heptadiene-3’5-dionato-kO3’kO5] difluoroboron (CRANAD-2) [26] was purchased from Sigma-Aldrich AG ...
-
bioRxiv - Developmental Biology 2022Quote: ... transgenic and mutant zebrafish embryos were raised at 28°C in Embryo Water (Volvic© water containing 0.28 mg/mL Methylene Blue [M-4159; Sigma] and 0.03 mg/mL 1-phenyl-2-thiourea [P-7629; Sigma]), and staged according to Westerfield (Westerfield ...
-
bioRxiv - Developmental Biology 2019Quote: ... All animals were incubated at 28.5°C for 24h before treatment with 1-phenyl-2-thiourea (PTU) (Sigma Aldrich) to prevent pigment formation.
-
bioRxiv - Cell Biology 2019Quote: ... and then kept in E3 medium supplemented with 0.3 µg/ml of methylene blue and 0.003% 1-phenyl-2-thiourea (Sigma-Aldrich) to prevent melanin synthesis ...
-
bioRxiv - Developmental Biology 2023Quote: Embryos used later than 34 hours post-fertilization were kept transparent by soaking them in embryo medium (Danieau’s Solution) with 1% 1-phenyl-2-thiourea (PTU) (Sigma) to inhibit pigment formation (M. ...
-
bioRxiv - Cell Biology 2023Quote: ... buffered with 0.15 mM HEPES (pH = 7.6) and supplemented with 200 mM of 1-Phenyl-2-thiourea (Sigma-Aldrich) to inhibit the melanogenesis ...
-
bioRxiv - Cancer Biology 2020Quote: ... and blocked for one hour in 5% BSA (Sigma). Blots were incubated in primary antibody to SHMT1 (Cell Signaling ...
-
bioRxiv - Genetics 2021Quote: ... was propagated and maintained by transferring shoot segments of 3-4 cm with 1-2 young leaves to fresh one-half Murashige and Skoog (Beijing, China, Sigma-Aldrich). Plantlets were grown at 23 ℃ under a 16 h light/8 h dark cycle with a light intensity of illumination of 5000 lux provided by cool white fluorescent lamp tubes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2023Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′- TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous reference (PPIA ...
-
bioRxiv - Immunology 2021Quote: Blood was extracted from hBLT mice at 3 and 5-6 weeks post-infection and lysed with Red Blood Cell Lysis Buffer (SIGMA). T cells were activated for 1.5 h with 5μl/ml of anti-CD28 and anti-CD49d in the presence or absence of 6.4μg/ml of a Gag pool of peptides in the presence of 0.5μg/ml Brefeldin A ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then treated with 6-thio-dG (3-5 μM) in the presence of 500 ng/ml doxycycline (Sigma), washed three times with warm PBS and allowed to recover in regular growth medium containing 500 ng/ml doxycycline ...
-
bioRxiv - Neuroscience 2022Quote: ... mito-tempol[23] (25 μg, Sanbio) and oligodeoxynucleotide (3 μg/μl day 4, 5 and 6 after carrageenan, Sigma-Aldrich), were performed under light isoflurane anesthesia as described.[8a ...
-
bioRxiv - Plant Biology 2024Quote: ... meliloti 1021 (pXLGD4) strain were stained using 5-bromo-6-chloro-3-indolyl-β-d-galactopyranoside (Magenta-Gal, Sigma-Aldrich), according to the protocol described previously by Jarzyniak et al ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Genetics 2019Quote: BzATP (2′(3′)-O-(4-Benzoylbenzoyl) adenosine 5′-triphosphate triethylammonium salt) was purchased from Millipore Sigma and ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Neuroscience 2021Quote: ... The sections were counterstained with 5 μM 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (Sigma-Aldrich, Cat# D9542) in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for 5 min with 10 μg/ml 4’,6-Diamidino-2-phenylindole (DAPI; Sigma-Aldrich) to stain cell nuclei ...
-
bioRxiv - Neuroscience 2023Quote: Refractive index matching was achieved by incubating the cleared brains in CUBIC-R+(M) (45 wt% 2,3-dimethyl-1-phenyl-5-pyrazole [Antipyrine; #10784, Sigma-Aldrich, Germany] ...
-
bioRxiv - Microbiology 2023Quote: ... blocked for one hour in blocking buffer (3% goat serum and 3% BSA in PBS (Sigma)) and incubated with pneumococcal antisera Pool Q (SSI Diagnostica ...
-
bioRxiv - Developmental Biology 2020Quote: ... and developed 3-6 hours in BM Purple (Sigma). Nuclear fast red (Sigma ...