Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 0.625 mM methyl-β-cyclodextrin (Sigma), 0.3 unit/mL of hydrolase sphingomyelinase (Sigma) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tetramethylrhodamine methyl ester (TMRM; Sigma-Aldrich) was measured at 561 nmEx/586 nmEm ...
-
bioRxiv - Genomics 2023Quote: ... then quickly was cut to small pieces (1-3 mm) in petri dish with 3 -5 ml RMPI medium containing 0.05mg/ml TM Liberase (Sigma Aldrich, 5401119001) and 0.02 mg/ml DNAaseI (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... BubR1 5’GAUGGUGAAUUGUGGAAUAdTdT3’) or luciferase (5’ CGUACGCGGAAUACUUCGAdTdT 3’) was synthesized from Sigma and used for the RNAi.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Both fins of each genotyped larva were dissected and transferred to a drop of Methyl Cellulose 3% (M0387, Sigma-Aldrich) on a slide for documentation using an Olympus SZX16 (Model SZX2-ILLB ...
-
bioRxiv - Microbiology 2022Quote: ... embryos were mechanically dechorionated if necessary and anaesthetized in 0.02 % (w/v) buffered 3-aminobenzoic acid methyl ester (pH 7.0) (Tricaine; Sigma-Aldrich, A5040). The bacterial suspension was then injected into the hindbrain ventricle of casper zebrafish larvae at 2 dpf ...
-
bioRxiv - Biophysics 2021Quote: D-glucose and 3-O-methyl-D-glucose powder for in vitro studies were obtained from Sigma-Aldrich (Milan, Italy). Solutions of D-glucose and 3OMG for in vitro studies were prepared in 10 mM phosphate-buffered saline (PBS 1X) ...
-
bioRxiv - Cell Biology 2021Quote: ... sphere (1.5 μm – 3 μm)) coated with 8.45 mM poly(ethylene glycol)methyl ether thiol (Mn 800, Cat. No. 729108, Sigma Aldrich) solution for 2 h at room temperature were used ...
-
bioRxiv - Neuroscience 2022Quote: ... All larvae were then anaesthetized in 0.02 % (w/v) buffered 3-aminobenzoic acid methyl ester at pH = 7.0 (Tricaine; Sigma-Aldrich, A5040), immediately de-yolked in de-yolking buffer (55 mM NaCl ...
-
bioRxiv - Immunology 2023Quote: ... 3 dpf larvae were anesthetized in 0.02 % (w/v) buffered 3-aminobenzoic acid methyl ester (pH 7.0) (Tricaine; Sigma-Aldrich, A5040). The corresponding concentration of bacteria was injected into the corresponding part of the zebrafish ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2-(14-carboxytetradecyl)-2-ethyl-4,4-di methyl-3-oxazolidinyloxy (16-doxyl-stearicacid, 16-DSA, cat. no. 253596) from Sigma-Aldrich. 5-DSA (spin probe containing the nitroxide group attached on C5 that is located on the opposite terminal relative to the charged carboxyl fatty acid terminus ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were mounted after 4′,6-diamidino-2-phenylindole (DAPI) staining (1:5 000, Sigma-Aldrich, USA). Confocal images were captured under 20× objective using A-1R Confocal Microscope (Nikon ...
-
bioRxiv - Cell Biology 2021Quote: ... with a 3:1 concentrated solution of 20 nm:5 nm colloidal gold (Sigma Aldrich) blocked with bovine serum albumin ...
-
bioRxiv - Biophysics 2022Quote: Methyl-β-cyclodextrin-treated cells were incubated in 10 mM methyl-β-cyclodextrin (Sigma-Aldrich, C4555-5G) for 15 min before imaging ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pellets were resuspended at an OD600 of 1 in 5 ml of agroinfiltration buffer (10 mM MgCl2 and 250 μM of 3’,5’-Dimethoxy-4’-hydroxyacetophenone (Sigma-Aldrich)) ...
-
bioRxiv - Neuroscience 2020Quote: ... were performed in DJ-1-deficient cells with MTT (3-(4, 5-dimethylthiazol-2-yl)−2–5-diphenyltetrazolium bromide) (Sigma-Aldrich) as described in [24] ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fluorescein 5(6)-isothiocyanate (FITC) were purchased from Sigma Aldrich. IgG-AlexaFluor555 from Abcam ...
-
bioRxiv - Cancer Biology 2019Quote: 6-Diazo-5-oxo-L-norleucine (Don, D2141, Sigma, UK); Sodium dichloroacetate (DCA ...
-
bioRxiv - Immunology 2020Quote: ... 4 or 6 h with staurosporine (5 µg/ml, Sigma) at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... One of these wells received 5 µM 6-TG (Sigma) in DMSO for negative selection and the other received DMSO as a control (mock selection) ...
-
bioRxiv - Biochemistry 2023Quote: ... and FAM (5(6)-carboxyfluorescein) were purchased from Sigma-Aldrich. D-biotin was purchased from GoldBio ...
-
bioRxiv - Immunology 2022Quote: ... 1:5000 (6-11B-1, Sigma-Aldrich) overnight at 4 0C ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1 mixture (Sigma-Aldrich, #D6421-6), Neurobasal medium (Life technologies #21103-049) ...
-
bioRxiv - Systems Biology 2023Quote: ... Each cage was provided with a 30 ml glass bottle filled with a solution of 5% glucose and 0.4% methylparaben (methyl 4-hydroxybenzoate, Sigma). A vertically rolled up Whatman filter paper was inserted to soak up the sugar solution and allow mosquitoes to feed on.
-
bioRxiv - Cell Biology 2023Quote: For lipid raft disruption microglial cells were pre-incubated with 5 mM of methyl-β-cyclodextrin (MβCD) (Sigma-Aldrich) for 1 hour.
-
bioRxiv - Cancer Biology 2021Quote: ... and 1% Glycerol) containing a 3-fold dilutions (from 0.125 units/ml to 6 units/ml) of Benzonase nuclease (Millipore). This was mixed gently and incubated for three minutes at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Adult zebrafish (6 female and 6 male) were anesthetized in 0.02% tricaine (E10521, Ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich). Shallow lesions were made on the skin (10 on each side ...
-
bioRxiv - Genomics 2019Quote: ... and 3 × 10−5 mM hydrocortisone (Sigma H0888) in 6 well plates (Figure 1) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Genetics 2019Quote: ... 1 mM and 10 mM L-dopa precursor (Methyl L-DOPA hydrochloride) (Sigma Aldrich) were dissolved in water before adding to liquefied fly media.
-
bioRxiv - Systems Biology 2020Quote: ... we added 750μM of 1-Methyl-2-vinylpyridinium (M2VP, Sigma-Aldrich Cat. No. 69701), which is a thiol scavenging agent that rapidly masks reduced glutathione (42 ...
-
bioRxiv - Biochemistry 2022Quote: ... tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (34 μM, Sigma, 678937), copper(II ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM Tris-[(1-benzyl-1H-1,2,3-triazol-4-yl)-methyl]-amin (Sigma Aldrich), and 1 mM sodium ascorbate ...
-
bioRxiv - Plant Biology 2023Quote: ... attenuata plants (32-day-old) were sprayed with 1 mM methyl jasmonate (MeJA, Sigma) or 5 mM ethephon (2-chloroethanephosphonic acid ...
-
bioRxiv - Molecular Biology 2023Quote: ... tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA, Sigma-Aldrich, 678937) and palmitoyl coenzyme A (≥ 90% ...
-
bioRxiv - Microbiology 2023Quote: ... 62.5 µM tris[(1-benzyl-1H-1,2,3-triazol-4- yl)methyl]amine (TBTA) (Sigma), 1.25 mM CuSO4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 mL N–methyl–N–(tert– butyldimethylsilyl)trifluor-oacetamide + 1% tert–Butyldimethylchlorosilane (Sigma 375934) was added to the sample and incubated at 60°C for 1 hour ...