Labshake search
Citations for Millipore Sigma :
201 - 250 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bixafen, (N-(3’,4’-dichloro-5-fluorobiphenyl-2-yl)-3-(difluoromethyl)-1-methylpyrazole-4-carboxamide) (Bixafen, (Sigma-Aldrich, St ...
-
bioRxiv - Developmental Biology 2019Quote: ... Methyl Green (1:5000, M8884 Millipore Sigma, (Prieto et al., 2015)) was added to embryos after immunohistochemistry for several hours ...
-
bioRxiv - Biophysics 2020Quote: ... 10 µg ml-1 tosyl arginine methyl ester (TAME, #283096 Sigma), 1 µg ml-1 pepstatin A (#P5318 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1(S),9(R)-(-)-bicuculline methyl bromide (50 µM, Sigma-Aldrich).
-
bioRxiv - Microbiology 2021Quote: ... 100 μM tris((1-benzyl-4- triazolyl)methyl)amine (TBTA; Sigma), and 1 mM CuSO4 (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... sperm were imaged in M2 media or 1% methyl cellulose (Sigma), in capillary tubes (Vitrotubes Mountain Leaks ...
-
bioRxiv - Microbiology 2020Quote: ... at 1 mg/mL or cholesterol-depleting methyl-β-cyclodextrin (Sigma) at 20 mg/mL was added for 1 hour prior to the experiment ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4% Methyl Green (Sigma, diluted 1:250; Prieto et al., 2015) or 4′,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and 1 μg/mL tosylphenylalanyl chloride methyl ketone (TPCK) trypsin (Sigma). At 72-hour post-transfection ...
-
bioRxiv - Genomics 2024Quote: Isopentane (2-methyl butane; EMD Millipore/MilliporeSigma, cat. no. MX0760-1)
-
bioRxiv - Cancer Biology 2023Quote: ... and Asymmetric Di-Methyl Arginine ASYM25 (Sigma, #09-814, 1:1000).
-
bioRxiv - Molecular Biology 2023Quote: ... or 1 mM Leu-Leu-O-methyl ester (LLOMe) (Sigma, L1002) was added to the wells for 1 hour ...
-
bioRxiv - Immunology 2021Quote: ... 5-A-RU was synthesised as described previously (120) and combined with methyl-glyoxal (Sigma-Aldrich) immediately before addition to the culture ...
-
bioRxiv - Physiology 2019Quote: ... Sample mixture was then incubated with 5 mL of methyl tert-butyl ether (MTBE ;Sigma-Aldrich) for 1h at RT under gently shaking ...
-
bioRxiv - Cancer Biology 2019Quote: HBP inhibition in vivo was achieved by treatment of tumor bearing mice with 3 doses (10 mg/kg) of DON (6-Diazo-5-oxo-L-norleucine, Sigma-Aldrich) every 3 days ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Microbiology 2024Quote: ... The cells were overlaid with 1:1 volume of 2 % methyl cellulose (Sigma, USA) in 2X MEM supplemented with 5 % FBS and plate was incubated for 48 h ...
-
bioRxiv - Biophysics 2021Quote: ... 5(6)-Carboxyfluorescein was purchased from Sigma-Aldrich. Methyl-α-cyclodextrin (MαCD ...
-
bioRxiv - Microbiology 2021Quote: ... 6 mM MnCl2 (Sigma-Aldrich, 7773-01-5), 0.7 mM dNTPs with 10 U SuperScript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... and 5 U glucose 6-phospahte dehydrogenase (Sigma).
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM EDTA (Sigma-Aldrich, 6381-92-6) and protease and phosphatase inhibitors (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437, Sigma Aldrich) for 24 hours prior to collection of cells for RNA extraction.
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... The internal standard was 1 μL of methyl heneicosanoate (10 mg/mL) and Bacterial acid methyl ester (BAME) mix (Merck-Millipore, Burlington, MA, USA) was used to identify the each peak of fatty acids and analytical standards for each fatty acid were used for quantification.
-
bioRxiv - Cell Biology 2020Quote: ... 3-Isobutyl-1-methylxanthine (15879) and 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (B7880) were purchased from Sigma. Phosphodiesterase inhibitor Tocriset containing Milrinone ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mg ml-1 of 3–5 kDa fluorescein isothio-cyanate (FITC)-dextran (Sigma-Aldrich, Germany) in phenol-red free DMEM/F12 medium (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were infected with pLKO.1 control or pLKO.1-shZSCAN4 (5’-GAATGCAACAACTCTTGTAATCTCGAGATTACAAGAGTTGTTGCATTCT-3’, Millipore Sigma) and further selected with Puromycin (1ug/ml ...
-
bioRxiv - Microbiology 2022Quote: ... the msfGFP levels were normalized for OD600 and converted to absolute units using 5(6)-carboxyfluorescein (5(6)-FAM) (Sigma Aldrich) as a calibrant (36 ...
-
bioRxiv - Microbiology 2023Quote: ... The relative msfGFP measurements were normalised for their respective OD600 values and subsequently converted to absolute units of the calibrant 5(6)-carboxyfluorescein (5(6)-FAM)) (Sigma-Aldrich). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: Ethanol 95% (v/v) and (-)-nicotine hydrogen tartrate salt ((-)-1 -Methyl-2-(3-pyridyl) pyrrolidine (+)-bitartrate salt were purchesed by Sigma Aldrich (St. Louis, MO, USA). The CB1/2 receptor agonist (R)-(+)-[2,3-Dihydro-5-methyl-3-(4-morpholinylmethyl)pyrrolo[1,2,3-de]-1,4-benzoxazin-6-yl]-1-naphthalenylmethanone mesylate ...
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 mM EDTA and either re-seeded with split ratios (1:3 to 1:8) onto 6-well plates or cryopreserved using CryoStor CS10 Cryopreservation Reagent (Sigma). iPSC lines were maintained in 5% CO2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were passaged at a 1:3 to 1:6 ratio every 7 days using cell dissociation solution-non enzymatic (Sigma) and plated in fresh BME matrix droplets.
-
bioRxiv - Biophysics 2021Quote: ... methyl viologen from Sigma (856177), and COT from Sigma (138924) ...