Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Plant Biology 2020Quote: ... 3 mM MgCl2) containing 80 μl NBT (Sigma) (35mg/ml in70% DMSO and 30 μl de BCIP (Sigma) (50 mg/ml in 100% de DMSO ...
-
bioRxiv - Cell Biology 2021Quote: ... the pellet from every one-liter fresh cell culture was de-ciliated with 3 mM dibucaine (Sigma-Aldrich) in 150 mL fresh SSP medium ...
-
bioRxiv - Biophysics 2022Quote: ... De-fatted Human Serum Albumin (DE-HSA) lyophilized powder was purchased from Sigma-Aldrich (product no ...
-
bioRxiv - Bioengineering 2020Quote: ... The O/N culture was back-diluted 1:300 in 3 mL fresh Cal18-2 medium85 (Glucidex 12 was exchanged for Maltodextrin DE 13-17 (Sigma-Aldrich, Saint Louis, MO, USA) supplemented with chloramphenicol also in an Axygen 24-deep well plate ...
-
bioRxiv - Neuroscience 2021Quote: ... and for 1h in a peroxidase conjugated extravidin (Sigma, 1:1000 in PBS) solution in the dark ...
-
bioRxiv - Biochemistry 2020Quote: ... tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (34 μM, Sigma), copper(II ...
-
bioRxiv - Physiology 2023Quote: ... Some conditions were performed with 1-100 μM [1H]ADP (Sigma A 5285) or with 5 μM carboxyatractyloside (Cayman Chemical Item No ...
-
bioRxiv - Biochemistry 2023Quote: ... tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (34 μM, Sigma), copper (II ...
-
bioRxiv - Biochemistry 2020Quote: ... 7-dehydrocholesterol (Sigma Aldrich, DE), cholesterol and ergosterol (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... 7-dehydrocholesterol (Sigma Aldrich, DE), cholesterol and ergosterol (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mowiol (Sigma-Aldrich, Seelze, DE)-mounted cells were then analyzed with Leica SP8 CLSM (Leica ...
-
bioRxiv - Cell Biology 2021Quote: ... differentiated HNEC cultures were incubated for 1h in ALI-differentiation medium supplemented with 5 µg/ml polybrene (Millipore) before infection.
-
bioRxiv - Biophysics 2020Quote: ... Micropatterns were printed for 5 min with specifically designed chrome masks and coated for 1h at 5% CO2 and 37°C with 50μg/mL fibronectin and 20μg/mL Alexa 546–fibrinogen (Sigma) diluted in distilled water ...
-
bioRxiv - Neuroscience 2020Quote: 6-Cyano-7-nitroquinoxaline-2,3-dione (CNQX) was obtained from Sigma-Aldrich (Cat No. C127). Tetrodotoxin (TTX ...
-
bioRxiv - Neuroscience 2021Quote: ... MK-801 and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) all purchased from Sigma-Aldrich, also with AR-C155858 and (S)-3,5-Dihydroxyphenylglycine hydrate (DHPG ...
-
bioRxiv - Neuroscience 2024Quote: ... BrdU was dissolved in 0.9% NaCl and injected at a concentration of 100 mg/kg 3 times each 2h (Sigma-Aldrich, Buchs, Switzerland). CldU was dissolved in 0.9% NaCl and injected at a concentration of 42.5 mg/kg either 3 times each 9h for the experiment about quiescence exit in vivo ...
-
bioRxiv - Cell Biology 2023Quote: ... and probed with the desmin antibody (DE-U-10, Sigma, 1:10,000) or the A11 antibody (kindly provided by Dr ...
-
bioRxiv - Cell Biology 2021Quote: Fertilized eggs were de-jellied for 5 min with a solution containing 0.5 g of cysteine (Sigma) and 500 μl of 5N NaOH ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Physiology 2024Quote: ... Some vessel segments were incubated with L-NAME (N-nitro-L-arginine methyl ester 100 μmol.L-1, Sigma-Aldrich), The mechanical activity was isometrically recorded using a force transducer and a data acquisition system (DATAQ Instruments ...
-
bioRxiv - Cell Biology 2021Quote: ... N omega-nitro-L-arginine methyl ester hydrochloride (L-NAME; 0.15mM; Sigma), N-([3-(aminomethyl)phenyl] methyl ...
-
bioRxiv - Neuroscience 2024Quote: ... Nω-Nitro-L-arginine methyl ester hydrochloride (L-NAME, Sigma-Aldrich, N5751), BIBP3226 (1 µM ...
-
bioRxiv - Cell Biology 2020Quote: ... were blocked for 1h in TBS containing 0.1% Tween-20 (TBS-T) supplemented by 3% fatty-acid free BSA (Sigma Aldrich) before incubation with the purified STARD10 protein (1 μg/mL in TBS-T + 3% BSA ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed three times for 5 min in PBS before blocking for 1h at room temperature with 3 % BSA in PBS-Triton 0.01 % (Triton X-100, Sigma, T8787). Cells were then incubated with primary antibody in blocking buffer (3 % BSA in PBS-Triton 0.01 % ...
-
bioRxiv - Genetics 2023Quote: ... beads were rewashed 3 times 5 minutes with 1× wash buffer (Sigma-Aldrich, W0390) on a rotator and with protease and phosphatase inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... from QIAGEN or costume siRNA against MdmX (siMdmX#1, sequence: 5’-AGAUUCAGCUGGUUAUUAA-3’) from Sigma-Aldrich. For Spry4 knockdown cells were transfected with a pool of 3 siRNAs against Spry4 (s37824 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were incubated for 1-2h at 37°C with 250 μg/ml RNase A (Sigma) in 2x SSC ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Biochemistry 2021Quote: ... 5(6)-carboxyfluorescein (3 eq, Sigma-Aldrich) was activated with PyAOP (3 eq ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Microbiology 2024Quote: ... 3-Methyladenine (5 mM, Millipore Sigma, M9281), lactostatin (1 µM ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 g/L U-[2H] glucose (Sigma-Aldrich, St ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, purity > 98%) was purchased from Sigma-Aldrich (St. Louis, MO, USA).
-
bioRxiv - Neuroscience 2021Quote: ... washed 3 times for 5 min with PBS and permeabilized for 1h at room temperature (permeabilization buffer: 2,5% donkey serum (Sigma), 1% BSA ...
-
bioRxiv - Physiology 2020Quote: ... Slides were then washed twice in warm water for 5 min and stained for 1h at RT with Picro-Sirius Red solution (0.1% (m/v) Sirius Red (Sigma) in saturated aqueous solution of Picric Acid (LabChem)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the zebrafish larvae were permeabilized for 1h at RT with a blocking buffer [5% BSA (A9647-10G, Sigma-Aldrich), 5% sheep serum (013-000-1210 ...
-
bioRxiv - Biochemistry 2022Quote: ... tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (34 μM, Sigma, 678937), copper(II ...
-
bioRxiv - Biochemistry 2022Quote: ... tris(1-benzyl-1H-1,2,3-triazol-4-yl-)methylamine (TBTA, 100 μM, Sigma-Aldrich), and CuSO4 (1 mM ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM Tris-[(1-benzyl-1H-1,2,3-triazol-4-yl)-methyl]-amin (Sigma Aldrich), and 1 mM sodium ascorbate ...
-
bioRxiv - Microbiology 2021Quote: ... for 1h at room temperature and washed twice with 1 x DPBS (Sigma-Aldrich). Target cells were seeded at 4 × 104 cells/well (293T ...
-
bioRxiv - Molecular Biology 2023Quote: ... tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA, Sigma-Aldrich, 678937) and palmitoyl coenzyme A (≥ 90% ...
-
bioRxiv - Microbiology 2023Quote: ... 62.5 µM tris[(1-benzyl-1H-1,2,3-triazol-4- yl)methyl]amine (TBTA) (Sigma), 1.25 mM CuSO4 ...