Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... 2H2O M9 media containing 1 g/L 15NH4Cl and 0.5 g/L 2H/15N-labeled ISOGRO (Millipore-Sigma, Burlington, MA). In both cases ...
-
bioRxiv - Microbiology 2023Quote: Protein extract from leaf tissue was incubated for 2h at 4°C with an anti-flag mouse antibody at 1:4,000 dilution (Sigma, F1804), followed by a 1h-incubation at 4°C with PureProteomeProtein A/G Magnetic Beads Mix (Millipore) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The supernatant was collected and centrifuged at 900g for 5mins and GLP-1 secretion over 1h treatment with GYP was measured using a total GLP-1 ELISA kit (Millipore, UK) according to manufacturer’s specifications.
-
bioRxiv - Plant Biology 2020Quote: ... 150 µM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone; SIGMA, USA) at a 23.7×108 cfu/ml (OD600=0.75 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 100 µM acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone, Sigma D134406), and incubated for 6h at 28°C at 150 rpm.
-
bioRxiv - Microbiology 2021Quote: ... 5 × 10−3 g/L human insulin (Sigma Aldrich, USA), 5 × 10−5 M hydrocortisone (Upjohn Laboratories SERB ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse Primer 5’-TGGTTGAGCACAGGGTACTT-3’] were synthesized by Sigma-Aldrich, USA ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 μM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone) (SIGMA, USA) carrying the corresponding binary plasmids (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 and phosphatase (phosphatase inhibitor cocktail 3, Sigma) and protease inhibitors (EDTA free cOmplete™ protease inhibitors ...
-
bioRxiv - Biochemistry 2021Quote: ... 5-Bromo-4-Chloro-3-Indolyl-phosphate (BCIP, Sigma B8503) was used as the chromogenic substrate.
-
bioRxiv - Cell Biology 2021Quote: ... (3) TGFβ2 (5 ng/ml) + GsMTx4 (500 nM; Sigma-Aldrich), or (4 ...
-
bioRxiv - Physiology 2022Quote: ... 3 nM 3,3’,5-Triiodo-L-thyronine sodium salt (Sigma), 10 ng/ml EGF (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membranes were blocked in 3-5% skimmed milk (Sigma) dissolved in Tris buffered saline + 0.2% v/v Tween-20 (TBST) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2’-O-dibutyryladenosine 3:5-cyclic monophosphate (dbcAMP; Sigma-Aldrich), and 0.1 mM 3-isobutyl-1-methyl xanthine (IBMX ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (Sigma) was used at a final concentration of 1mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate; Sigma).
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM 3-indol-acetic acid (IAA; Sigma-Aldrich, I2886) was added 1 h prior to adding phleomycin or β-estradiol.
-
bioRxiv - Cancer Biology 2024Quote: ... cells were exposed to 3-Methyladenine (5 mM; Sigma, M9281) for 24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... and the sequences of the siRNAs targeting DDX42 were siDDX42-1: 5’-CAGAAUGCCUGGUUUCGGA-3’ (SASI_Hs01_00119846, Sigma-Aldrich®), siDDX42-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... we delivered the Iκ-kinase inhibitor [5-(p-Fluorophenyl)-2-ureido]thiophene-3-carboxamide (TPCA-1; Sigma-Aldrich CAS 507475-17-4 ...
-
bioRxiv - Microbiology 2023Quote: ... 3 ×104 THP-1 cells were seeded and differentiated by the addition of 5 ng/ml PMA (Sigma) in complete RPMI media (Himedia ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were treated with 10 μM of the agonist N-[(3R)-1-Azabiciclo[2.2.2]oct-3-yl]furo[2,3-c]pyridine-5-carboxamide (PHA-543613, from Sigma, PZ0135) for 30 min ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 7.4) for 3 minutes and incubated with PLA probe anti-mouse-MINUS (1:5) (DUO92004, Sigma-Aldrich) or anti-goat-MINUS (1:5 ...
-
bioRxiv - Microbiology 2023Quote: The small interfering RNAs (siRNAs) against NLRP3 (siNLRP3) (5’-UGCAAGAUCUCUCAGCAAA-3’) and the corresponding control siRNAs (siControl) (5’-UUCAAUAAAUUCUUGAGGU-5’) were synthesized from Sigma. The siGenome smart pool siRNAs and siON Target plus siRNAs were purchased from Dharmacon and are composed of a pool of four siRNAs ...
-
bioRxiv - Neuroscience 2024Quote: ... brain sections were washed in phosphate buffer (PB) and incubated 1h in a solution containing equal volumes of 3% potassium ferrocyanide (Sigma-Aldrich, Ontario, Canada, cat# P9387) with 4% osmium tetroxide (EMS ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated in staining solution containing 0.675mg/mL nitro blue tetrazolium (NBT Sigma Cat# 11585029001) and 0.35mg/mL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP Sigma Cat# B6149) ...
-
bioRxiv - Physiology 2023Quote: ... N(ω)-nitro-L-arginine methyl ester (L-NAME, 0.5 g/L, pH = 7.4, Sigma-Aldrich) was added to light-sensitive bottles of cages administered HFD ...
-
bioRxiv - Molecular Biology 2023Quote: Contents of superoxide radical were visualized using nitro blue tetrazolium chloride (NBT, Sigma-Aldrich [USA], 93862). Single leaves or whole rosette leaves from 4-week-old plants were incubated in NBT staining solution (25 mM HEPES/KOH ...
-
bioRxiv - Cell Biology 2024Quote: ... Hypertension was induced by addition of L-NAME (L-NG-Nitro arginine methyl ester, Sigma-Aldrich) to drinking water at a final concentration of 0.5 g/L at pH=7.4 for six weeks ...
-
bioRxiv - Immunology 2020Quote: ... and product intensity measured by Software ImageJ(83) and normalized to ACTIN amplicon products (5’-GACGACATGGAGAAAATCTG-3’ and 5’-ATGATCTGGGTCATCTTCTC-3’, Sigma-Aldrich, St. Louis, Missouri, USA).
-
bioRxiv - Neuroscience 2020Quote: ... were performed with MTT (3-(4, 5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) (Sigma-Aldrich) as described in Sanz et al ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% 3-methyl-1-butanethiol (Sigma W385808), 1% octanal (Sigma O5608) ...
-
bioRxiv - Neuroscience 2021Quote: ... For some experiments the AMPA/kainate glutamate receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, 25 μM, Sigma-Aldrich), the NMDA glutamate receptor antagonist [3H]3-(2-carboxypiperazin-4-yl ...
-
bioRxiv - Neuroscience 2020Quote: ... Spontaneous IPSCs were isolated by blocking AMPA receptor-mediated events with CNQX (6-cyano-7-nitroquinoxaline-2,3-dione; 20uM; Sigma-Aldrich). Miniature events were isolated by blocking sodium channels with the addition of tetrodotoxin (1uM ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2 mL of acid ninhydrin (glacial acetic acid, 6 M phosphoric acid, ninhydrin (2,2-dihydroxyindane-1,3-dione, Sigma, ON, Canada) were boiled in a water bath at 100 °C for 1 hr ...
-
bioRxiv - Neuroscience 2023Quote: ... and the AMPA receptor inhibitor 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, 10 µM, Sigma Aldrich, St Louis, MO, USA). This solution was applied to the autaptic culture neurons for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC; Sigma Aldrich #39391), and 3NPH solutions were mixed ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were treated with sodium arsenite (SA) (0.5mM, 1h, Sigma) to induce the formation of stress granules ...
-
bioRxiv - Cell Biology 2023Quote: ... were incubated for 1h at RT and DAPI (Sigma-Aldrich) was added for 10min to counterstain nuclei ...
-
bioRxiv - Immunology 2024Quote: ... T2 cells were treated for 1h with Mitomycin C (Sigma) at 20µg/ml (19) ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples were washed with phosphate sucrose buffer 0,1M, post-fixed (1h, 4°C) with 1 % osmium tetroxide (TAAB Laboratories) in potassium ferricyanide 0,8% (Sigma) and incubated with 2% aqueous uranyl acetate (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2020Quote: ... then re-blocked and probed B-tubulin for 1h with the mouse anti-ß-tubulin (1:1000; Sigma). Bands were analysed by area under curve relative to tubulin loading controls (Image Lab™ software).
-
bioRxiv - Neuroscience 2024Quote: ... containing 200 µM Tris [(1-benzyl-1H-1,2,3-triazol-4- yl)methyl]amine (TBTA; Sigma Aldrich, 678937-50MG), 500 µM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP ...
-
bioRxiv - Immunology 2023Quote: ... Cells were washed twice in ice-cold H2O-based PBS and lysed using lysis buffer (50 mM HEPES, 150 mM NaCl, 1% NP40 in ultrapure H2O containing 1:500 uniformly 2H-labelled 1,4-dioxane-d8 [Sigma Aldrich, 186406] as an internal standard) for 20 min at room temperature ...
-
bioRxiv - Physiology 2020Quote: ... 3-isobutyl-1-methylxanthine (Sigma); Glyh-101 (a gift from the Cystic Fibrosis Foundation Therapeutics and Robert Bridges ...