Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and 4-bromobenzoic acid were obtained from Sigma-Aldrich. High crystallinity PET film (ES301250 ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-cis 4-trans-abscisic acid (Sigma, Cat # 862169) at 10µM was prepared in ethanol and sterile filtrated with 0.2 µm filter ...
-
bioRxiv - Immunology 2024Quote: ... 4-aminobenzoic acid hydrazide (ABAH, Sigma-Aldrich, A41909-10G), or diphenyleneiodonium chloride (DPI ...
-
bioRxiv - Microbiology 2024Quote: ... 4 g/L succinic acid (Sigma-Aldrich Ref: S3674) and pH was adjusted to 7.0 by using NaOH ...
-
bioRxiv - Biochemistry 2024Quote: ... and 4-methylumbelliferone-N-acetyl-neuraminic acid (Sigma-Aldrich) at a final concentration of 250 µM in 25 mM sodium acetate buffer ...
-
bioRxiv - Microbiology 2022Quote: ... 3 days post-infection 4 mL of paraformaldehyde 4% (#158127, Sigma) was added and incubated overnight at 4ºC ...
-
bioRxiv - Microbiology 2021Quote: ... 3% B where solvent A = 0.1% formic acid (FA, Sigma) in water (Thermo-Fisher ...
-
bioRxiv - Plant Biology 2020Quote: ... Lanolin paste containing Indole-3-acetic acid (IAA, Sigma-Aldrich) (10 mg of IAA per 1g of lanoline ...
-
bioRxiv - Molecular Biology 2020Quote: ... auxin (indole-3-acetic acid sodium salt, Sigma-Aldrich #I5148) was added to the culture medium in a final concentration of 0.5 mM for indicated times.
-
bioRxiv - Molecular Biology 2022Quote: ... and 50 mg/kg alizarin-3-methyliminodiacetic acid (Sigma, A3882) dissolved in 2% sodium bicarbonate solution were subcutaneously injected into mice at 5 day-intervals ...
-
bioRxiv - Neuroscience 2022Quote: ... A Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was additionally performed according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... A Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was additionally performed according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... hexadecanoic acid (CID: 57-10-3; Millipore Sigma; Catalog #:76119), heptadecanoic acid (CID ...
-
bioRxiv - Developmental Biology 2022Quote: ... 100 μM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma-Aldrich), 100 μM ethylene glycol bis (succinimidyl succinate ...
-
bioRxiv - Immunology 2020Quote: ... Indole-3-acetic acid (IAA, Sigma-Aldrich, #I3750-25G-A), was added in the medium at 500 μM from a 1000X stock that were prepared by dissolving IAA with DMSO ...
-
bioRxiv - Cell Biology 2023Quote: ... Erythroid progenitors were cultured with βOHB (3-Hydroxybutyric acid, Sigma), fatostatin (HY-14452 ...
-
bioRxiv - Cell Biology 2022Quote: ... into 3 volumes of concentrated sulfuric acid (>95%, Sigma-Aldrich) while stirring ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-indoleacetic acid (IAA) (500 μM, Sigma-Aldrich I5148-2G) was added overnight and present in the media in all the subsequent steps ...
-
bioRxiv - Cell Biology 2024Quote: ... were blocked with 3% fatty acid free BSA (#A7030, Sigma) in TBS for 1-2 hours at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... 750 µM indole-3-acetic acid sodium salt (IAA, Sigma) was supplemented to the medium and cells were incubated for the indicated time points before harvest.
-
bioRxiv - Microbiology 2023Quote: ... - 3-benzenedisulfonic acid (Tiron) and Bicyclomycin were purchased from Sigma.
-
bioRxiv - Biophysics 2023Quote: ... 50 mM 3-(cyclohexylamino)-1-propanesulfonic acid (CAPS, Millipore Sigma), 0.3% N-lauroyl sarcosine (Millipore Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2-Chloroquinoline-3-carboxylic acid (Sigma-Aldrich, cat. no 688517), 4-Chloro-DL-phenylalanine salt (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... in 3% v/v aqueous acetic acid (A6283, Sigma-Aldrich) solution for 5 minutes ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM 2-Imino-1-imidazolidineacetic acid (cyclocreatine, Sigma-Aldrich), 50 µM NG,NG-Dimethylarginine dihydrochloride (ADMA ...
-
bioRxiv - Cell Biology 2022Quote: For the auxin (3-indole acetic acid, Sigma # I2886, USA) mediated protein degradation ...
-
bioRxiv - Genomics 2023Quote: ... and 0.5 mM indole-3-acetic acid (IAA, Sigma, I5148) and cells were refreshed every 2-3 days ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 µM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma-Aldrich), 100 µM ethylene glycol bis (succinimidyl succinate ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 mM 3-mBz (m-toluic acid, Sigma-Aldrich) to induce msfGFP production ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 µM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma-Aldrich), 100 µM ethylene glycol bis(succinimidyl succinate ...
-
bioRxiv - Microbiology 2024Quote: ... 50mg 3-(Acrylamido) phenylboronic acid (Sigma Aldrich Cat No. 771465), 1ml 10X RNase-free TAE ...
-
bioRxiv - Immunology 2024Quote: ... and 15 acid-washed 3-mm glass beads (Sigma-Aldrich). Total RNA was isolated from a volume of lung homogenate equivalent to 30 mg of tissue using the RNeasy Tissue Kit and RNase-Free DNase Set (both Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... Washed beads were adjusted to pH 7.5 with 200 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) and bound proteins were reduced using 5 mM dithiothreitol (Sigma-Aldrich) at 37°C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... and eluted directly onto the MALDI plate using 1 μL of 5 mg/mL alpha-cyano-4-hydroxycinnamic acid (CHCA, Sigma-Aldrich) in 50% (v/v ...
-
bioRxiv - Cell Biology 2022Quote: ... followed immediately by an equal volume of a freshly-prepared 5 mg/mL solution of 4-hydroxy-α-cyano-cinnamic acid (Sigma) in 50% aqueous (v:v ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mg of 4-OHT (Sigma H7904) were dissolved in 120μl of ethanol ...
-
bioRxiv - Immunology 2022Quote: ... We used 3-4 synthetic sgRNAs (Sigma) per gene ...
-
bioRxiv - Biophysics 2024Quote: ... 4% (3-Aminopropyl) triethoxysilane (APTES) (Sigma-Aldrich)-treated and 2% glutaraldehyde (Sigma-Aldrich)-activated 35mm glass-bottom dishes (Ibidi ...
-
bioRxiv - Genomics 2021Quote: ... cells were first washed once with phosphate-buffered saline (PBS) and supplemented with equilibrated (37 °C and 5% CO2) medium containing 500 μM indole-3-acetic acid (Sigma-Aldrich, I5148) freshly prepared before use ...
-
bioRxiv - Plant Biology 2023Quote: ... 4-day old Col_0 seedlings were incubated with LRC liquid medium supplemented with indicated concentrations of compounds (Adenosine 5′-triphosphate magnesium salt, ATP-Mg [VWR]; Abscisic acid, ABA [Sigma-Aldrich]; Carbonyl cyanide 3-chlorophenylhydrazone, CCCP [Sigma-Aldrich] ...
-
bioRxiv - Bioengineering 2022Quote: ... cell-seeded wells (n=3 per group) were rinsed with PBS and incubated in 500 μL of 5% trichloroacetic acid (TCA, Sigma-Aldrich, T6399) in UPW for 30 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Mice were administered (poly [4-styrenesulfonic acid-co-maleic acid] (PSCMA) (Sigma Aldrich, St. Louis, MO) (∼480 mg/kg body weight/day ...
-
bioRxiv - Immunology 2021Quote: ... 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium (BCIP /NBT) liquid substrates for AP-enzyme (SIGMA) were added for overnight incubation at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol-4’,5’-bisphosphate) (ammonium salt) (PI(4,5)P2) (Sigma 850155P), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC ...