Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... together with 4 g of acid-washed glass beads (Sigma Aldrich) and the samples were vortexed for 10 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... pentanoic acid (CID: 109-52-4; Millipore Sigma; Catalog #: 75054-1ML), hexanoic acid(CID ...
-
bioRxiv - Bioengineering 2021Quote: ... and a saturating quantity of α-Cyano-4-hydroxycinnamic acid (Sigma) matrix ...
-
bioRxiv - Biochemistry 2020Quote: ... and α-cyano-4-hydroxycinnamic acid (CHCA) were from Sigma-Aldrich, now Merck (Dorset ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma, #H0887) and 100 U/ml penicillin/100 μg/ml streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma, #H0887) and 100 U/ml penicillin/100 μg/ml streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... A saturated solution of α-cyano-4-hydroxycinnamic acid (Sigma-Aldrich) was used for the matrix solution by dissolving with a 2:1 solution of ultrapure water:acetonitrile (Ing et al. ...
-
bioRxiv - Immunology 2022Quote: ... PMNs were stimulated with 4 μM ionomycin (free acid, Sigma-Aldrich), 100 nM Phorbol 12-myristate 13-acetate (PMA ...
-
bioRxiv - Immunology 2024Quote: ... 4) triglicerides: oleic acid triglyceride (TG) was purchased from Sigma (T7140); 5 ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 mL of 2% acetic acid in diethyl ether (Sigma-Aldrich) were used to elute the free fatty acid fraction ...
-
bioRxiv - Biophysics 2024Quote: ... Eicosapentaenoic acid (EPA) (Sigma-Aldrich, E2011, CAS number: 10417-94-4), dihomo-γ-linolenic acid (DGLA ...
-
bioRxiv - Biochemistry 2024Quote: ... Alpha-cyano-4-hydroxycinnamic acid matrix (CHCA) (Sigma-Aldrich, Munich, Germany) (10 mg/mL ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Biochemistry 2024Quote: The DNA used in the crystallization of the NtcA-2OG-DNA complex was prepared by 10-min heating at 65°C of an equimolar mixture of the synthetic oligodesoxyribonucleotides 5’-AGCTGATACATAAAAAT-3’ and 5’-CATTTTTATGTATC-3’ (from Sigma) in 5 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2024Quote: ... MICAL1#2 (5′CUCGGUGCUAAGAAGUUCU[dU][dU]3′) (75) and Rab35 (5′GCUCACGAAGAACAGUAAA[dU][dU]3′) (76) were synthetized by Sigma.
-
bioRxiv - Cell Biology 2024Quote: ... two siRNA sequences targeting different regions of NOK were designed as #1: 5’-GCAAGAAACAUUCAUGCAU-3’ and #2: 5’-GUCUUUCCCAGGGACACAA-3’ (SASI_Hs01_00043410 and SASI_Hs02_00351937, Sigma, St. Louis, MO, USA). The control siRNA is a scrambled sequence (5’-UUCUCCGAACGUGUCACGUdTdT-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... The signal was determined by nitroblue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (toluidine salt) (BCIP) (Sigma, 72091).Semithin sections for toluidine blue myelin staining and ultrathin section for TEM imaging were prepared according to our previous protocols (Zhang et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... at 60°C and developed using nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) (Sigma Aldrich) for 60 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fertilized oocytes were collected from 3-4 week-old superovulated C57Bl6 females prepared by injecting 5 IU each of pregnant mare serum gonadotrophin (PMSG) (Sigma Aldrich) and human chorionic gonadotropin (hCG ...
-
bioRxiv - Microbiology 2020Quote: ... a 1:10,000 anti-rabbit dilution of IgG alkaline phosphatase was used before detection with NBP-BCIP (nitroblue tetrazolium chloride–5-bromo-4-chloro-3′-indolylphosphate; Sigma-Aldrich) as the substrate.
-
bioRxiv - Plant Biology 2021Quote: ... sucrose (#S/8600/60, Fisher) and 100 μM 3’,5’-dimethoxy-4’-hydroxyacetophenone (acetosyringone) (#115540050, Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (#D8418, SIGMA)) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of the DIG-labelled probes was carried out by using an anti-DIG antibody coupled with alkaline phosphatase and a ready-to-use 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro-blue tetrazolium (NBT) solution (Sigma-Aldrich) as the chromogenic substrate for the enzyme ...
-
bioRxiv - Bioengineering 2022Quote: ... Bone-marrow derived hMSCs (hBMSCs) were frozen at passage 3 or 4 with 5*106 cells/ml in freezing medium containing FBS (BCBV7611, Sigma-Aldrich) with 10% DMSO and stored in liquid nitrogen until further use ...
-
bioRxiv - Developmental Biology 2020Quote: ... The staining reactions lasted between 2h and 8h at room temperature using nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3′-indolyphosphate (BCIP) staining reactions (Sigma Aldrich). Embryos were then rinsed in PBS-T (0.05% Tween-20) ...
-
bioRxiv - Plant Biology 2020Quote: ... and placed in Petri dishes filled with 0.5% agarose containing 35 mM β-mercaptoethanol (v/v) and 1.5 mg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Sigma). For X-gal staining ...
-
bioRxiv - Microbiology 2022Quote: ... Detection was performed by colorimetry using nitro blue tetrazolium chloride / 5-bromo-4-chloro-3-indolyl-phosphate (NBT-BCIP, Sigma-Aldrich) as a substrate.
-
bioRxiv - Neuroscience 2024Quote: ... The medium was changed every 3–4 d and enriched with granulocyte-macrophage colony-stimulating factor (5 ng/ml GM-CSF, Sigma-Aldrich). After approximately 14 d at 37°C and 5% CO2 ...
-
bioRxiv - Biochemistry 2024Quote: ... The samples were then incubated for 2-3 hours at 4°C with either 5 μl of anti-FLAG-M2 affinity resin (Sigma-Aldrich), Streptactin sepharose (IBA Lifesciences) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1% Triton X-100] and incubated for 2-3 hours at 4°C with either 5 μl of anti-FLAG-M2 affinity resin (Sigma-Aldrich), Streptactin sepharose (IBA Lifesciences) ...
-
bioRxiv - Biochemistry 2024Quote: ... 3-4 µL was separated using a Millipore SeQuant ZIC-pHILIC (2.1 × 150 mm, 5 µm particle size, Millipore Sigma #150460) column with a ZIC-pHILIC guard column (20 x 2.1 mm ...
-
bioRxiv - Neuroscience 2020Quote: Auxin plates were prepared by adding auxin Indole-3-Acetic Acid (Sigma) from a 400 mM stock solution in ethanol into NGM at the final concentration of 1 mM (Zhang et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... a 400x stock solution of 3-indoleacetic acid (auxin, Sigma Aldrich, I2886) in 100% ethanol was prepared ...
-
bioRxiv - Biochemistry 2020Quote: ... Membrane strips were blocked with 3% fatty acid free BSA (Sigma Aldrich) and then incubated with 100 nM recombinant His-tagged WT/R47H TREM2 ECD diluted in blocking buffer at 4°C for 1 hour ...
-
bioRxiv - Systems Biology 2020Quote: ... and 0.6% sulfosalicylic acid (Sigma-Aldrich; Cat#S2130; CAS: 5965-83-3) in KPE ...
-
bioRxiv - Genomics 2021Quote: Auxin (IAA, 3-Indoleacetic acid) was purchased from Millipore Sigma (45533-250MG) and dissolved in ethanol ...
-
bioRxiv - Genetics 2020Quote: ... 137.14 mg of 2-methylpyridine-3-carboxylic acid (Sigma Aldrich, cat. 325228) were resuspended in 500 μl DMSO anhydrous (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: βOHB was (R)-(–)-3-Hydroxybutyric acid sodium salt from Sigma-Aldrich (#298360). Butyrate was Sodium butyrate from Sigma-Aldrich (#303410).
-
bioRxiv - Cell Biology 2022Quote: ... we first added the auxin indole-3-acetic acid (I5148, Sigma-Aldrich) from a 500 mM stock solution in DMSO ...
-
bioRxiv - Cell Biology 2020Quote: ... The strips were blocked with 3% fatty acid-free BSA (Sigma-Aldrich) in PBS-T (PBS ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... cells were incubated with 500 μM indole-3-acetic acid (IAA) (Sigma) for the indicated times.