Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 5 g/L L-glutamic acid (Sigma-Aldrich) and 0.1 mg/mL each of required amino acids ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sigma Aldrich 34860)/5% glacial acetic acid (GAA, Sigma Aldrich A6283) at -20°C for 4 hours ...
-
bioRxiv - Biophysics 2022Quote: ... and boric acid (5 mg/ml, Sigma-Aldrich). Next ...
-
bioRxiv - Biophysics 2020Quote: 5) Ethylenediaminetetraacetic (EDTA) acid solution (Sigma, 03690-100ML)
-
bioRxiv - Neuroscience 2021Quote: ... and 5% acetic acid (volume:volume; Sigma-Aldrich 338826) was poured into each chamber and allowed to set for 30 minutes before females were introduced by gentle aspiration 13,37 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 8-hydroxy-5-quinolinecarboxylic acid (Sigma-Aldrich; SML0057), S-(5′-Adenosyl)-L-homocysteine (Sigma-Aldrich ...
-
bioRxiv - Systems Biology 2022Quote: ... Digestion was stopped using 5% trifluoracetic acid (Sigma) to pH 2 to 3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μg/mL of ascorbic acid (Sigma-Aldrich), 1% of chemically defined lipid concentrate (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM Valproic acid sodium salt (Sigma-Aldrich) and 10 mL of 45% D-(+)-Glucose solution (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... Hyaluronic acid (5 mg/mL) from Sigma Aldrich was mixed in the above solvent and stirred for overnight (12 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM ethylenediaminetetraacetic acid (pH 8.0; Sigma-Aldrich); 1 mg/ml of yeast tRNA (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... L-2-amino-5-phosphonovaleric acid (AP5, Sigma) were included ...
-
bioRxiv - Microbiology 2023Quote: ... γ-Aminobutyric acid (5 M GABA; Sigma Aldrich) was used as the internal standard ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, #E9884) supplemented with 1:500 protease inhibitor (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... 5 μL of acrylic acid (Sigma-Aldrich, 147230), 2.5 μl Tetramethylethylenediamine (TEMED ...
-
bioRxiv - Microbiology 2021Quote: ... or the same isosmotic solution with 100 µM of the general anion channel inhibitor 5-Nitro-2-(3-phenylpropylamino) benzoic acid (NPPB, Sigma-Aldrich), which inhibits malarial new permeation pathways (59) ...
-
bioRxiv - Microbiology 2023Quote: Cross-linking experiments were performed by incubation of 2 mM and 5 mM of suberic-bis-acid ester (3-sulfo-N-hydroxyuccinimy (BS3, Sigma-Aldrich) with the purified recombinant protein in 25 mM sodium phosphate pH 7.4 for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... Flash-frozen plant samples (0.2 g) were ground and extracted using 2 mL of 3 % 5-sulfosalicylic acid (Sigma, ON, Canada). The extract was centrifuged for 10 min at 8050 x g at 4 °C ...
-
bioRxiv - Bioengineering 2022Quote: ... HA-TBA was dissolved in anhydrous DMSO (2 wt%) with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Cell Biology 2024Quote: ... After 5 h of incubation the culture medium was de-proteinized by adding an equal volume of 3% trichloroacetic acid (Sigma # T6399) and incubation at 50 °C for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... After the last EtOH wash the coverslips were incubated with methanol containing 5% acetic acid and 1% (3-Aminopropyl)triethoxysilane (Millipore-Sigma) overnight in a vacuum desiccation chamber in the dark ...
-
bioRxiv - Bioengineering 2021Quote: Before staining with either 5-bromo-4-chloro-3′-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, Sigma-Aldrich) for alkaline phosphatase (ALP ...
-
bioRxiv - Developmental Biology 2021Quote: ... and color was developed with 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT; Sigma). Following color development ...
-
bioRxiv - Neuroscience 2023Quote: ... Larvae were incubated overnight from 4 dpf in 3 ml 10 mM 5-Bromo-2′-deoxyuridine (B5002, Sigma) with 1% DMSO for 17 hours ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bands were stained in 5-bromo-4-chloro-3-indolyl-phosphate and nitro blue tetrazolium solution (Sigma-Aldrich). The membrane image was acquired using a digital steel camera EOS M6 mark II with a lens EF16-35 mm F4L IS USM (Canon Inc. ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: A total of 150 µL of 3% 4-ethoxymethylene-2-phenyl-2-oxazolin-5-one (oxazolone; Sigma-Aldrich) dissolved in 100% ethanol (Wako ...
-
bioRxiv - Cancer Biology 2020Quote: ... alpha-cyano-4-hydroxycinnamic acid (CHCA) and Trifluoroacetic acid (TFA) were purchased from Sigma-Aldrich. Histological-grade xylenes was purchased from Spectrum Chemical ...
-
bioRxiv - Pathology 2022Quote: ... Day 7 differentiated WT and ABHD4 KO 3T3-L1 adipocytes were labeled with 0.5 μCi [14C]-acetic acid or 5 μCi [3H]-oleic acid plus 0.04 mM oleic acid (Sigma-Aldrich) conjugated with 0.01 mM fatty acid free-bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2023Quote: ... Crypts were treated from seeding on with 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich).
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng/mL interleukin-4 (IL-4, Sigma-Aldrich) and 0.5 μg/mL anti-CD180 (BD PharMingen) ...
-
bioRxiv - Bioengineering 2022Quote: ... tissues were washed with 4% deoxycholic acid (Sigma-Aldrich) (w/v ...
-
bioRxiv - Neuroscience 2020Quote: ... after fixation in 4% trichloroacetic acid (Sigma-Aldrich, T9159) (44) ...
-
bioRxiv - Cell Biology 2020Quote: ... MALDI matrix α-cyano-4-hydroxycinnamic acid (CHCA, Sigma; 50% acetonitrile/0.1% trifluoroacetic acid ...