Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma) or fixable viability dye 405 (eBiosciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma). Flow cytometry was performed on a MACSQuant Analyzer 10 (Miltenyi Biotec) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μl of the reducing reagent (mixture of 0.2 g 1-amino-2-naphtol-4-sulfonic acid (Millipore-Sigma, Burlington, MA, USA, #08751) with 0.2 g sodium bisulfite (Millipore-Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; 5 µg/ml, Sigma-Aldrich) at room temperature for 20 minutes.
-
bioRxiv - Neuroscience 2022Quote: ... Sections were mounted after 4′,6-diamidino-2-phenylindole (DAPI) staining (1:5 000, Sigma-Aldrich, USA). Confocal images were captured under 20× objective using A-1R Confocal Microscope (Nikon ...
-
bioRxiv - Developmental Biology 2022Quote: ... and (+−)-6-hydroxy-2,5,7,8- tetra- methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Potassium chloride (cat ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... and (+−)-6-hydroxy-2,5,7,8-tetra-methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. 1× Phosphate Buffered Saline (PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... the DNA was stained with 5 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, D9542-5MG, SIGMA) diluted in 2% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... and (+−)-6-hydroxy-2,5,7,8-tetra-methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Sodium hydroxide (cat ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mL of linear gradient of 0 mM to 2 mM of mannose 6-phosphate (Sigma, M3655) by mixing buffer A and buffer B (50 mM NaOAc ...
-
bioRxiv - Cell Biology 2021Quote: ... were reared in 10g/l of glucose/200µM of 3BDO (3-Benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one) (Sigma Aldrich) supplemented in standard fly food ...
-
bioRxiv - Bioengineering 2021Quote: ... We added 2-amino-thioxanthone (17.2 μmol, 2 equ) in dimethylsulfoxide (DMSO, 0.1 mL, Sigma) to a solution of PA-Rho (8.6 μmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 0.1% 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl)_(NBD-PE) in a 4:1 mixture of silicone oil (Sigma-Aldrich) and mineral oil (Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Three more washing steps with TBS were performed before resolving the staining with 5 ml of substrate per membrane: a 30 mg tablet of 4-chloro-1-naphthol (Sigma) dissolved in 10 ml of methanol ...
-
bioRxiv - Cancer Biology 2023Quote: ... staining solution (0.3 mg/ml of 5-bromo4-chloro-3indolyl β-D-galactoside, X-Gal Fermentas R0401, 40 mM citric acid, Sigma C-0759 ...
-
bioRxiv - Biophysics 2020Quote: ... the larvae were anesthetized with tricaine (3-amino benzoic acidethylester, Sigma Aldrich, MO) and immobilized in 1% low-melting-point agarose inside FEP (Fluorinated Ethylene Propylene ...
-
bioRxiv - Biochemistry 2020Quote: ... then visualized using 400 μL 8 mg/mL 3-amino-9-ethylcarbazole (Sigma) in 10 mL 50 mM sodium acetate (Fisher ...
-
bioRxiv - Plant Biology 2022Quote: ... The basal medium also contained 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma) for selection ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were developed using 3,3’-diaminobenzidine or 3-amino-9-ethyl carbazole (Sigma) and counterstained with hematoxylin.
-
bioRxiv - Bioengineering 2024Quote: ... ExtrAvidin® Peroxidase and 3-amino-9-ethylcarbazole (AEC) substrate solution (Sigma Aldrich) was used to visualize brown immune complex reaction product ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The cultures were then induced in SGDCAA (6.7 g/L YNB without amino acid [VWR #90004-150], 5 g/L ammonium sulfate [Sigma-Aldrich #A4418], 2% galactose [Sigma-Aldrich #G0625] ...
-
bioRxiv - Microbiology 2022Quote: ... 5(6)-carboxyfluorescein (CF) was from Sigma. EM104 10ml glass syringes from Sanitex international.
-
bioRxiv - Neuroscience 2022Quote: ... 1% non-essential amino acids and 0.1 mM 2-mercaptoethanol (Sigma) for EB formation ...
-
bioRxiv - Genetics 2020Quote: ... 0.1mM non-essential amino acids and 0.1mM 2-mercaptoethanol (Sigma-Aldrich), before being plated onto 0.1% gelatin-coated cover slips ...
-
bioRxiv - Cell Biology 2022Quote: ... rinsed in PBS and incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) at RT for 30min ...
-
bioRxiv - Immunology 2024Quote: ... or (E)-2-Benzylidene-3-(cyclohexylamino)-2,3-dihydro-1H-inden-1-one (BCI, DUSP 1/6 inhibitor, Cat# 317496, Sigma) at different concentrations as indicated for each experimental condition ...
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of 3×106 co-transformants was initially screened for growth on synthetic defined media (SD)-Leu-/ Trp-/ Ura-/ His- media containing 20mM of 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich). Plasmids were isolated from the potential positive colonies ...
-
bioRxiv - Neuroscience 2020Quote: ... Sigma)10,42 and the metabotropic glutamate receptor antagonist DL-2-Amino-3-phosphonopropionic acid (AP-3) ([1mg/kg] in PBS, stock made in 1M NaOH diluted, pH 7.4; Sigma)10,43 ...
-
bioRxiv - Immunology 2024Quote: ... cells (1-2.5×105 cells/well) were stimulated with a pool of 18-amino acid peptides overlapping by 15 amino acids (Sigma Aldrich) spanning the Chlamydia muridarum CPAF S491A antigen (final concentration of 2.5μg/ml)27 on PVDF-membrane plates (Millipore ...
-
bioRxiv - Developmental Biology 2021Quote: ... and then in Nitro Blue Tetrazolium (Sigma-Aldrich, N6639-1G) and 5-bromo-4-chloro-3-indolyl phosphate (Sigma-Aldrich ...
-
bioRxiv - Physiology 2022Quote: ... Nω-nitro-L-arginine methyl ester (L-NAME) (Sigma-Aldrich) was added to the drinking water (0.5 g/L ...
-
bioRxiv - Pathology 2023Quote: ... For L-NAME (NG-nitro-L-arginine methyl ester) (Sigma) treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2024Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′-TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous references (PPIA ...
-
bioRxiv - Biophysics 2024Quote: ... respectively: EcoEF7,3_For: 5’-GCACTATTTGCTATATATTGTGTGGTTGAATCTTTTTTCAACTACATCTAGTATCTC-3’ and EcoEF7,3_Rev: 5’-GAGATACTAGATGTAGTTGAAAAAAGATTCAACCACACAATATATAGCAAATAGTGC-3’ were ordered from Sigma-Aldrich, resuspended and annealed in buffer containing 10 mM Tris pH 7 ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction was stopped by the addition of 28 μl of a stop reaction mixture: 3 μl of the reducing reagent (mixture of 0.2 g 1-amino-2-naphtol-4-sulfonic acid (Millipore-Sigma, Burlington, MA, USA, #08751) with 0.2 g sodium bisulfite (Millipore-Sigma ...
-
bioRxiv - Immunology 2021Quote: Blood was extracted from hBLT mice at 3 and 5-6 weeks post-infection and lysed with Red Blood Cell Lysis Buffer (SIGMA). T cells were activated for 1.5 h with 5μl/ml of anti-CD28 and anti-CD49d in the presence or absence of 6.4μg/ml of a Gag pool of peptides in the presence of 0.5μg/ml Brefeldin A ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then treated with 6-thio-dG (3-5 μM) in the presence of 500 ng/ml doxycycline (Sigma), washed three times with warm PBS and allowed to recover in regular growth medium containing 500 ng/ml doxycycline ...
-
bioRxiv - Neuroscience 2022Quote: ... mito-tempol[23] (25 μg, Sanbio) and oligodeoxynucleotide (3 μg/μl day 4, 5 and 6 after carrageenan, Sigma-Aldrich), were performed under light isoflurane anesthesia as described.[8a ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 µL of cell suspension was mixed with 5 µL of fibrinogen solution (6 mg/mL, final concentration 3 mg/mL, 8630, Sigma) by pipetting up and down three times ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were untreated or treated with 100 nM 2-chloro-N6-cyclopentyadenosine (CCPA) (Sigma-Aldrich, St. Louis, Missouri, United States) for 30 min for CCPA only group ...
-
bioRxiv - Immunology 2024Quote: ... 8-Cyclopentyl-1,3-dipropylxanthine (DPCPX)(28, 33, 34) or A1 receptor agonist 2-Chloro-N6-cyclopentyladenosine (35) were purchased from Sigma Aldrich, dissolved in DMSO and filter sterilized by passing through a 0.22μm filter prior to use ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were counterstained with 5 μM 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (Sigma-Aldrich, Cat# D9542) in PBS ...