Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... After 24 h media/inhibitor was aspirated and replaced with 20 μl of 5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) and incubated at 37°C in 5% CO2 for 3 h ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and from days 3-5 with 5 μM IWR-1 (Sigma). From days 13-19 metabolic selection medium was used ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were dehydrated in increasing concentrations of ethanol for 5 min each (2 × 35%, 50%, 70%, 80%, 90%, 3 × 100%) and washed 3 x 5 min with propylene oxide (Sigma- Aldrich, #cat 110205-18L-C). Sections were next embedded overnight at RT in Durcupan resin (20g component A ...
-
bioRxiv - Genomics 2021Quote: ... A single colony was transferred to 5 mL YNB without amino acids (Sigma Y1250) prepared according to the manufacturer’s instructions plus 2% glucose ...
-
bioRxiv - Cell Biology 2021Quote: ... N omega-nitro-L-arginine methyl ester hydrochloride (L-NAME; 0.15mM; Sigma), N-([3-(aminomethyl)phenyl] methyl ...
-
bioRxiv - Neuroscience 2024Quote: ... Nω-Nitro-L-arginine methyl ester hydrochloride (L-NAME, Sigma-Aldrich, N5751), BIBP3226 (1 µM ...
-
bioRxiv - Biophysics 2021Quote: ... and 5(6)-carboxyfluorescein were purchased from Sigma-Aldrich. Methanol (LC/MS grade ...
-
bioRxiv - Biochemistry 2021Quote: ... G6PD (1M 6-aminonicotinamide, Sigma, Cat#329-89-5), PKM (20μM Compound 3K ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μM 6-azauridine (catalogue no. A1888; Sigma-Aldrich), 5 μM HCQ (catalogue no ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 μL of fibrinogen (6 mg/ml, Sigma, UK), and 5 μL of thrombin (4 units/ml ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Microbiology 2024Quote: ... 3-Methyladenine (5 mM, Millipore Sigma, M9281), lactostatin (1 µM ...
-
bioRxiv - Developmental Biology 2021Quote: Larvae at 2-6 dpf were first anesthetized with 0.03 % Ethyl 3-aminobenzoate methane sulfonate salt (Sigma-Aldrich, St. Louis, MO, USA) and pinned onto a Sylgard-filled recording chamber (I-2450 ...
-
bioRxiv - Genomics 2024Quote: ... Samples were stained with 1xTBS with 0.1% (v/v) Tween-20 and 3 mg/mL PVSA with 2ug/mL 4’,6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542) for 5-10 minutes at room temperature manually and rinsed three times with 1xTBS with 0.1% (v/v ...
-
bioRxiv - Genomics 2024Quote: ... formamide in 1xTBS with 0.1% (v/v) Tween-20 and 3 mg/mL PVSA with 2ug/mL 4’,6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542). Readout probes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2021Quote: ... medium, containing 3% sucrose, 10−6 M potassium indole acetate (Nacalai Tesque, Kyoto, Japan) and 10−5 M kinetin (Sigma, St. Louis, MO) at 25 °C ...
-
bioRxiv - Genetics 2023Quote: ... Fish were anaesthetised for live imaging using Tricaine methanesulfonate (3-amino benzoic acidethylester; Sigma Aldrich, E10521) at a final concentration of 0.016% in E3 embryo medium (5 mM NaCl ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5% 2-mercaptoethanl (Sigma) by incubating the beads at 100°C for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 5% 2-mercaptoethanol (Sigma) and fractionated by SDS-PAGE using the Mini-PROTEAN Tetra System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol (Sigma), and incubated at room temperature instead of boiled ...
-
bioRxiv - Microbiology 2022Quote: 7 mmol ABTS (2,2’-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid, Sigma) stock solution was mixed with 2.45 mmol potassium persulfate (K2S2O8 ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of 6-OHDA in 0.01% ascorbate (Sigma–Aldrich) into the median forebrain bundle (MFB ...
-
bioRxiv - Neuroscience 2023Quote: ... 2,2’-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS, Sigma-Aldrich) substrate was added to each well ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Molecular Biology 2024Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’- GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’- AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Bioengineering 2020Quote: ... gels were fabricated with a final concentration of 1×105 AFC/mL (P3-5) and incubated in EGM-2 +/- 1 mg/mL of the plasmin inhibitor 6-aminocaproic acid (Sigma, A2504) at 37°C and 5% CO2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a freshly prepared solution of 5-(6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA; Sigma-Aldrich Co., St. Louis, MO, USA) in DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... was used diluted at 4 μg/mL in PBS and incubated for 30 min with 5 μg/mL 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS to stain nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were centrifuged for 5 min at 700g and treated for 10 min with DAPI (4’,6-diamidino-2-phenylindole) (1:4000, Sigma, 62248) to label dead cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cryosections were then counterstained (5 min) with 0.5 µg/ml 4’,6’-diamino-2-phenylindole (DAPI; Sigma-Aldrich® Cat#D9542) in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... counter-stained with 4’,6-diamidino-2-phenylindole (DAPI) for 5 minutes at room temperature and mounted with Fluoroshield (Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2022Quote: ... The cells were washed in PBS and stained with 5 µg/ml 4′,6-Diamidino-2- phenylindole (DAPI) (D9564-10MG, Sigma-Aldrich) in 1xPBS+0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... The cells were then centrifuged at 200 rcf for 5 min and resuspended at a density of 2×105 cells/ml in ultra-low attachment 6-well plates (Sigma, CLS3471) using N2B27 medium (50% Advanced DMEM/F12 (ThermoFisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... nuclei and actin were stained in PBST containing 5 µg/ml 4′,6-diamidino-2– phenylindole dihydrochloride (DAPI; D9542, Sigma-Aldrich) and Alexa Fluor 488 phalloidin (diluted in 1/100 ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ug mL-1 N-(6-(isopropylsulfonyl)quinolin-4-yl)benzo[d]thiazol-5-amine hydrochloride (GSK’872) (Sigma-Aldrich # 5303890001) and 2 ug mL-1 Necrosulfanamide (EMD Millipore #480073 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μM 5-bromo-2’-deoxyuridine (BrdU, Sigma-Aldrich) was added into the culture medium for 10 h ...
-
bioRxiv - Genomics 2020Quote: ... 5-aza-2’-deoxycytidine (5-aza-dC, Sigma, A3656) was diluted in DMSO at a concentration of 10mM and Abl.1 cells were treated using a concentration range of 10 nM to 20 μM 5-aza-2’-deoxycytidine ...
-
bioRxiv - Bioengineering 2021Quote: ... they were anaesthetized in 3-amino benzoic acid ethyl ester (Tricaine/ethyl 3-aminobenzoate; Sigma Aldrich; 168 μg·ml−1 in Tris pH 7) and embedded in 1% low melting point agarose (UltraPure Agarose ...
-
bioRxiv - Physiology 2020Quote: The reduction of yellow tetrazolium salt 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich, Germany) was used to measure cellular metabolic activity as a proxy for cell viability [19,22] ...