Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Biophysics 2021Quote: ... 5(6)-Carboxyfluorescein was purchased from Sigma-Aldrich. Methyl-α-cyclodextrin (MαCD ...
-
bioRxiv - Microbiology 2021Quote: ... 6 mM MnCl2 (Sigma-Aldrich, 7773-01-5), 0.7 mM dNTPs with 10 U SuperScript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM EDTA (Sigma-Aldrich, 6381-92-6) and protease and phosphatase inhibitors (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... lapachol (2-hydroxy-3-(3-methyl-2-butenyl)-1,4-naphthoquinone) were purchased from Sigma-Aldrich. Vismione H and madagascine were obtained from PGE2 fraction of Psorospermum glaberimum as previously described (Gallé ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM 2-hydrocycitrate (2-HC) (Sigma) was added to cell culture at indicated time points ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Cancer Biology 2024Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Neuroscience 2024Quote: 6–8-week-old mice received three intraperitoneal (i.p.) injections of 5-Bromo-2′-deoxyuridine (BrdU, Sigma Aldrich #B9285) at 100 mg/kg (i.p ...
-
bioRxiv - Cancer Biology 2024Quote: ... Glass micropipettes were backfilled with 133 mM of 5- or 6-carboxyfluorescein with a negative charge (-2) (Sigma-Aldrich) diluted in potassium acetate 0.1 M (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2024Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10uM N-methyl-N’-nitro-N-nitrosoguanidine (MNNG) (all from Sigma) or phosphorothioate oligo (IDT ...
-
bioRxiv - Immunology 2024Quote: ... a 10 mg nitro blue tetrazolium (NBT) tablet (Sigma-Aldrich N5514) was introduced to 50 mL of this mixture ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
Proteasome granular localization is regulated through mitochondrial respiration and kinase signalingbioRxiv - Cell Biology 2022Quote: ... and 2-[2-(3-chlorophenyl)hydrazinylidene]-propanedinitrile (CCCP) (Sigma), were used at final concentrations of 0.5 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-[2-(3-chlorophenyl)hydrazinylyidene]propanedinitrile (CCCP) (Sigma-Aldrich), rhodamine 123 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2-4 months old mice were orally gavaged with 3 x 2 (Mist1creERT/+KRASG12D/+) or 5 x 5 mg (Ptf1acreERT/+KRASG12D/+) of tamoxifen (TX; Sigma-Aldrich, T5648-5G) at Western University and 5 x 4 mg (Ela-creERT ...
-
bioRxiv - Microbiology 2023Quote: ... The relative msfGFP measurements were normalised for their respective OD600 values and subsequently converted to absolute units of the calibrant 5(6)-carboxyfluorescein (5(6)-FAM)) (Sigma-Aldrich). Finally ...
-
bioRxiv - Microbiology 2022Quote: ... the msfGFP levels were normalized for OD600 and converted to absolute units using 5(6)-carboxyfluorescein (5(6)-FAM) (Sigma Aldrich) as a calibrant (36 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Bioengineering 2020Quote: ... nalidixic acid (NA; N8878, BCBW6556), and 4′,6-diamidino-2-phenylindole (DAPI; D9542, 28718-90-3) were purchased from Sigma Aldrich, USA ...
-
bioRxiv - Cell Biology 2022Quote: The neuroprotective effect of CA against 6-OHDA was evaluated by MTT reagent (3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide) (Sigma Aldrich, UK, M5655) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2022Quote: ... After washed with PBS for 3 times and stained with DAPI (4’,6-diamidino-2-phenylindole) (50 ng/mL) (Sigma, USA) for 5 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... were washed two times with PBS and lysed by scraping into 500 μl per plate of lysis buffer (40 mM Tris/HCl pH 7.6, 8 M urea, EDTA-free protease inhibitor complete mini [Roche], and phosphatase inhibitor cocktails 1, 2, and 3 [Sigma-Aldrich] at 1× final concentration according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: Spheroids grown in collagen for 3/6 days underwent collagen digestion by incubation in DMEM without serum supplemented with 2 mg/ml collagenase (Sigma, C2139) for 45 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... PGM buffer (6% mannitol, 3% sucrose, M5524 MS salts (Sigma), M7150 vitamins (Sigma) ...
-
bioRxiv - Bioengineering 2020Quote: ... Embryos were anesthetized with tricaine (3-amino benzoic acidethylester, 0.2 mg/mL, Sigma Aldrich, MO), embedded in 1% low-melting-point agarose ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were resuspended in SC media containing 15 mM 3-amino-1,2,4-triazole (3AT; Sigma) and 5 µg/ml α-factor (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... The plates were developed with commercially available 3-Amino-9-ethylcarbazole (AEC) substrate (Sigma-Aldrich). The observed spots were counted using an ELISPOT plate reader by ZellNet and the final data was reported as spot forming cells (SFC ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 mM 5-Fluro-2’-deoxyuridine (SIGMA U3003). Cells were transfected at DIV17-19 with Lipofectamine 2000 (Invitrogen ...