Labshake search
Citations for Millipore Sigma :
3801 - 3850 of 4323 citations for Recombinant Human HAPLN1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... followed 48 hours later by intraperitoneal injection of 5 IU human chorionic gonadotropin (PMS from SIGMA, HGC from Millipore USA). Mouse zygotes were obtained by breeding B6/CBA stud males with superovulated B6/CBA females at a 1:1 ratio ...
-
bioRxiv - Neuroscience 2021Quote: ... followed 48 hours later by intraperitoneal injection of 5 IU human chorionic gonadotropin (PMS from SIGMA, HGC from Millipore USA). Mouse zygotes were obtained by breeding B6/CBA stud males with superovulated B6/CBA females at a 1:1 ratio ...
-
bioRxiv - Neuroscience 2022Quote: ... This cell line allows the induction of Ngn2 expression and the puromycin resistance gene by the addition of Doxycycline for differentiation into neurons.30 Human iPSCs were maintained in feeder-free culture using Matrigel (Sigma) coated plastic dishes and StemFlex medium (StemCell ...
-
bioRxiv - Microbiology 2022Quote: ... gonococci were incubated (5 min and in parallel with the infections outlined above) in SH- and antibiotic-free cell culture medium spiked with normal human complement (Sigma) to a final concentration of 6% ...
-
Inhibition of major histocompatibility complex-I antigen presentation by sarbecovirus ORF7a proteinsbioRxiv - Microbiology 2022Quote: ... and human alveolar basal epithelial A549 cell line were maintained in DMEM supplemented with 10% fetal bovine serum (Sigma F8067) and gentamicin (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Two pLKO.1 lentiviral vectors encoding for specific shRNA for two human MAPK7 mRNA sequences were used (TRCN0000010262/pLKO.1 and TRCN0000010275/pLKO.1, Sigma). Lentiviral particles were generated in HEK-293 cells by co-transfecting the virion vectors (psPAX2 and pMD2G ...
-
Structure and Neutralization Mechanism of a Human Antibody Targeting a Complex Epitope on Zika VirusbioRxiv - Microbiology 2022Quote: ... Plates were washed with TBS containing 0.2% Tween and incubated for 1 hour at 37°C with Goat anti-human Fc (Sigma, A9544) or Fab (Jackson immunoResearch AB_2337617 ...
-
bioRxiv - Cell Biology 2019Quote: Undifferentiated SGBS cells were plated at 50 % confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were trypsinized and seeded on top of glass coverslips coated with 10 μg/ml of human fibrinogen (Sigma-Aldrich). Cells were fixed two hours later with 2% formaldehyde (Tousimis ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected with human ASCL1 stealth siRNA (129901-HSS100744, Thermo-Fisher) using X-tremeGENE siRNA Transfection Reagent (4476115001, Sigma) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Concentrations of 29 cytokines/chemokines were measured in 2-4 biological replicates using MILLIPLEX Map Human Cytokine/Chemokine Magnetic Bead Panel (HCYTMAG-60K-PX29, #Millipore) according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... Samples were then diluted 1:2 in serum matrix for analysis with Milliplex Non-Human Primate Magnetic Bead Panel as per manufacturer’s instructions (Millipore Corporation). Concentrations for each cytokine were determined for all samples using the Bio-Plex 200 system (BioRad Laboratories Inc.).
-
bioRxiv - Microbiology 2021Quote: ... ScAb or mAb samples were incubated with the antigen in doubling dilutions and the binding was detected using anti-Human C Kappa horseradish peroxidase (HRP) conjugated secondary antibody (Sigma) (for scAbs ...
-
bioRxiv - Pathology 2021Quote: ... postmortem kidney was fixed in 20% formalin for 2 weeks and processed for free-?oating preparation as done for mouse tissue with one exception that anti-human CD31 antibody (CBL468, 1:20 dilution, Millipore) was used.
-
bioRxiv - Pathology 2021Quote: ... Cytokine profiling analysis was performed by Eve Technologies (Calgary, AB Canada) using the Milliplex MAP Human Cytokine/Chemokine Panel (Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Immunology 2021Quote: Primary human monocytes were isolated from buffy coats from healthy blood donors by density gradient centrifugation (Histopaque™, Sigma-Aldrich). For studies of monocytes and M1/M2-type macrophages ...
-
bioRxiv - Pathology 2019Quote: Seven-µm-thick sections of human or murine atrial samples were stained with PicroSirius red according to manufacturer’s instructions (Sigma-aldrich). Bright images were acquired with a Nikon DS-Ri1 camera coupled to Eclipse-Ti Nikon microscope and Nis-Element software (Nikon France S.A. ...
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Biochemistry 2020Quote: ... Non-glycosylated OCN or glycosylated OCN was incubated at 50ng/ml in the diluted plasma for two hours in the presence of different concentration of human plasmin (Sigma) ranging from 0 to 0.3U/ml ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed then sequentially incubated with anti-SARS-CoV-2 CR3022 antibody (Yuan et al., 2020) (1 μg/mL) and a HRP-conjugated goat anti-human IgG (Sigma) in PBS supplemented with 0.1% (w/v ...
-
bioRxiv - Systems Biology 2020Quote: Human embyronic kidney cells (HEK-293 cells) were grown as adherent cultures in DMEM with high glucose (Sigma-Aldrich D5796), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were incubated with the following primary antibodies for 1 h at room temperature in Abdil: mouse anti-human lamin A/C (1:200; Millipore), rabbit anti-lamin A/C (1:200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... All single-cell samples were distributed at 0.5×106 cells/mL for live staining with monoclonal mouse anti-human FOLR1 IgG1 (LS Bio) in DPBS with 2% v/v FBS (Sigma). Secondary staining for target was performed using QIFIKIT® (BIOCYTEX ...
-
bioRxiv - Microbiology 2021Quote: Madin-Darby canine kidney (MDCK) and human embryonic kidney 293T (293T) cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Sigma-Aldrich) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... plates were washed 4 times with PBST and further incubated with 100 μL per well of goat anti-human IgG (Fc specific)-Peroxidase antibody (1: 5000 dilution, Sigma) for 1 h at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: The human multiple myeloma cell line (MMCLs) MM.1S (ATCC, Manassas, VA, USA) was cultured in RPMI1640 media (Sigma, UK) and 20% FBS (Life Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Metaphase II-arrested oocytes tightly packed with cumulus cells were collected from the oviductal ampulla 14 h after hCG injection and placed in a 100-μl drop of human tubal fluid (HTF; Millipore) medium covered with mineral oil ...
-
bioRxiv - Cell Biology 2020Quote: ... A2780 human ovarian cancer cells (female) stably expressing Rab25 (Caswell et al., 2007) were maintained in RPMI-1640 medium (Sigma) supplemented with 10 % FCS ...
-
bioRxiv - Genetics 2021Quote: ... were superovulated by serial Pregnant Mare Serum Gonadotropin (5 IU per mouse, Prospec Protein Specialists) and human chorionic gonadotropin (5 IU, Millipore) injections 46 h apart ...
-
bioRxiv - Immunology 2020Quote: ... Freshly-isolated neutrophils were suspended at 106 or 5×106 cells/mL in RPMI media (containing 10% human AB serum (Sigma)) and incubated at 37°C and 5% CO2 for up to 18h ...
-
bioRxiv - Microbiology 2020Quote: rAkata EBV-infected cells was reactivated at 1×106 cells/mL with a goat polyclonal anti-human IgG Fc-specific antibody (Sigma) for 48 hours ...
-
bioRxiv - Microbiology 2020Quote: Human HeLa229 cells (ATCC CCL-2.1tm) and human epithelial conjunctival cells (Chang) were cultured in 10 % (v/v) heat inactivated FBS (Sigma-Aldrich) RPMI1640 + GlutaMAXtm medium (Gibcotm ...
-
bioRxiv - Immunology 2020Quote: ... the protein transferred membranes were blocked with 5% dry milk in PBST (PBS with 0.05% tween-20) overnight at 4°C and probed with goat anti-human IgG-HRP (Sigma-Aldrich, St ...
-
bioRxiv - Immunology 2020Quote: ... mononuclear cells were thawed and plated at 106 cells per cm2 in 20 ml RAB5 (RPMI with 5% human serum AB (Sigma), 2 mM L-alanyl-L-glutamine ...
-
bioRxiv - Microbiology 2021Quote: ... Parasite cultures were maintained in a sus-pension of human erythrocytes at 2% hematocrit in complete media (RPMI-1640, Millipore-Sigma, supplemented with 27mM sodium biocarbonate ...
-
bioRxiv - Microbiology 2021Quote: ... Parasite cultures were maintained in a sus-pension of human erythrocytes at 2% hematocrit in complete media (RPMI-1640, Millipore-Sigma ...
-
bioRxiv - Immunology 2021Quote: ... and PBS-treated (n ≥ 3) control human gut xenografts and mouse jejunum were purified using GenElute Mammalian Total RNA kit (Sigma) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA from human hippocampal and prefrontal cortex tissue and mouse hippocampal tissue was extracted with TRIzol reagent (Sigma-Aldrich) and 1 μg was reverse-transcribed using PrimeScriptTM RT Reagent Kit (perfect Real Time ...
-
bioRxiv - Neuroscience 2020Quote: ... SI and protein extracts from human and mouse samples were resolved in SDS-PAGE transferred to Immobilon-P PVDF membranes (Millipore). Membranes were activated with methanol and blocked with 4 % bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2022Quote: ... The slides containing hamster and human lung tissue sections were deparaffinized in xylene (Sigma-Aldrich Inc., MO, USA; catalog# 534056) and rehydrated in graded alcohols to water ...
-
bioRxiv - Bioengineering 2022Quote: ... Tumor Necrosis factor alpha (TNF-α)) was carried out with Human Cytokine/Chemokine Magnetic Bead Panel (MilliPlex MAP, Millipore, Sigma). Median fluorescence intensity of each analyte was read using a MAGPIX system (Luminex) ...
-
bioRxiv - Bioengineering 2022Quote: ... Tumor Necrosis factor alpha (TNF-α)) was carried out with Human Cytokine/Chemokine Magnetic Bead Panel (MilliPlex MAP, Millipore, Sigma). Median fluorescence intensity of each analyte was read using a MAGPIX system (Luminex) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and subcultured for 72 h in NK MACS medium supplemented with 5% human serum male AB plasma (#H4522, Sigma-Aldrich) and human IL-2 IS (200 IU/ml ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were counted and further diluted at the required concentration for the following procedures in RPMI 1640 containing 10mM HEPES (Roth) and 0.5% human serum albumin (Sigma Aldrich). Purity of the isolation was assessed by a cytospin assay (Cytospin 2 Zentrifuge ...
-
bioRxiv - Cell Biology 2022Quote: Human monocyte-derived macrophages were separated from healthy donor buffy coats by centrifugation through Histopaque 1077 (Sigma-Aldrich, Cat # H8889) gradient ...
-
bioRxiv - Immunology 2022Quote: ... Antibody production was conducted by co-transfection of the heavy and light chain expression vectors into Human HEK293 suspension culture cells (Expi293F) using polyethylene mine (Sigma). Cells were subsequently cultured for 4 days before being pelleted by centrifugation ...
-
bioRxiv - Microbiology 2022Quote: Total protein was extracted from LT toxin-treated (100ng/ml) human differentiated enteroid monolayers (235D line) and untreated control using radioimmunoprecipitation assay (RIPA) buffer (Sigma) containing protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2022Quote: ... The infectious blood meal consisted of a 2:1 mix of washed human erythrocytes and viral suspension supplemented with 10 mM ATP (Sigma). The infectious titers were 107 FFU/mL for DENV-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... To assess the NOTCH3 ECD deposits the tissues were incubated overnight at 4 °C with mouse monoclonal anti-human NOTCH3 ECD primary antibody (1:100, clone 1E4, Millipore) followed by detection with Alexa 594 conjugated anti-mouse secondary antibody (1:1000 ...