Labshake search
Citations for Millipore Sigma :
3801 - 3850 of 10000+ citations for PGFM ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: ... CaMKII was activated in this diluted lysate (in solution) by adding an activation buffer containing 5 μM Ca2+/CaM and 5 mM Tris-buffered TCEP (Sigma-Aldrich). After activation for 45 min ...
-
bioRxiv - Systems Biology 2020Quote: BALB/cJ mice were subjected to cutaneous Oxazolone (Oxa) challenge by applying 5% 4-Ethoxymethylene-2-phenyl-2-oxazolin-5-one (Sigma-Aldrich) in acetone and olive oil topical to the skin as described [74] ...
-
bioRxiv - Immunology 2020Quote: ... Mice were subjected to cutaneous immune challenge by applying 20 µl of 3-5% 4- Ethoxymethylene-2-phenyl-2-oxazolin-5-one (Sigma-Aldrich) in 1:2 acetone:olive oil ...
-
bioRxiv - Biochemistry 2020Quote: ... myoblasts were transfected at 60% confluency with DNA constructs expressing CMV-Cas9(D10A) and paired U6-gRNAs (5’-GTTGTTGCTGTCTTTCCCCAGG and 5’- ACCCCCGCTTCAACGCCCATGG) (Sigma Aldrich) using TransIT-X2 reagent (Mirus Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Unbound protein was washed off in PBST (3x 5 min) and bound protein was detected using HRP-conjugated anti-His antibody (1:2000 in 5% milk PBST; Novagen #71841). After 1 hour incubation at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... for 2 days with daily change and 5% ammonium solution (diluted with H2O to a final concentration of 5% v/v, 105432, Sigma-Aldrich) for 6h to decolorize ...
-
bioRxiv - Microbiology 2021Quote: ... with 1.5% agar supplemented with 2 mg/mL 5-Fluoroorotic acid (US Biological, USA) and 5 µg/mL uracil (Sigma-Aldrich USA). Confirmation of plasmid excision was made by negative selection in BHIS-15% thiamphenicol plates ...
-
bioRxiv - Developmental Biology 2021Quote: ... The sections were subsequently dehydrated 2x 5 min in 99% EtOH and 2x 5 min in Xylene prior to coverslip mounting using DPX (Sigma-Aldrich). All images were acquired on an Axio Scan.Z1 (Zeiss ...
-
bioRxiv - Microbiology 2022Quote: ... the msfGFP levels were normalized for OD600 and converted to absolute units using 5(6)-carboxyfluorescein (5(6)-FAM) (Sigma Aldrich) as a calibrant (36 ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were dissociated using accutase (37 °C, 5 min), centrifuged (300 g, 5 min) and resuspended in activator (containing collagen IV (Sigma-Aldrich), Laminin 521 (BioLamina) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were split in two and either 5 µL buffer or 5 µL 1 µg/µL Proteinase K (Millipore Sigma 3115887001) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were incubated overnight at 4°C with primary antibodies diluted either in 5% non-fat dry milk in TBST or 5% Bovine Serum Albumin (BSA, Sigma, # A7906) + 0.02% sodium azide in TBST ...
-
bioRxiv - Bioengineering 2022Quote: ... were weighted and digested overnight in papain digestion buffer (containing 100 mmol phosphate buffer, 5 mmol L-cystein, 5 mmol EDTA and 140 μg/ml papain (P4762, Sigma-Aldrich)) at 60 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were blocked using 5% nonfat milk for 30 minutes and incubated overnight in 5% milk with the following antibodies: PHGDH (1:1000, Sigma HPA021241), GAPDH (1:5000 ...
-
bioRxiv - Immunology 2022Quote: Mice were sensitized on the shaved back-skin for two consecutive days with 50 μl of 5% Oxa (4-Ethoxymethylen-2-phenyl-2-oxazolin-5-on, Sigma-Aldrich) diluted in methanol and acetone (1:1 ...
-
bioRxiv - Microbiology 2022Quote: ... and suspended at 2 x 104 cells/mL in Titan Cell Medium (TCM) composed by 5% Sabouraud, 5% inactivated Fetal Calf Serum (FCS, Biological Industries) and 15 µM sodium azide (Sigma Aldrich), diluted in 50 mM MOPS adjusted to pH 7.3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Slides were then washed 5-6x for 5 min with water and then rinsed in 1% Phosphomolybdic acid (Sigma-Aldrich, HT153) for 10 min and rinsed in water for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μl of 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT, 0.5 mg/ml in PBS, Sigma-Aldrich, USA) with 1 μM of menadione (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... 53 from the RNAi Consortium (clones TRCN0000087290 and TRCN0000087292 with target sequence 5’-GCGGGAGTATAGTGAGTTTAA-3’ and 5’-CGGACAGTTTGGCACAATCAA-3’, respectively, distributed by Sigma-Aldrich, Merck ...
-
bioRxiv - Microbiology 2022Quote: ... AT depots were cut into ≈ 20 mg explants and incubated for 2 hours at 37°C in 96-well plates containing 200 μL low glucose DMEM with 5% (w/v) fatty acid-free BSA and 5 μM of Triacsin C (Sigma, T4540) per well ...
-
bioRxiv - Bioengineering 2022Quote: ... dry weights of scaffolds were collected and samples were digested overnight in papain digestion buffer (containing 100 mmol phosphate buffer, 5 mmol L-cystein, 5 mmol EDTA and 140 µg/ml papain (P4762, Sigma-Aldrich)) at 60 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Negative selection was therefore carried out by culturing the parasites in the presence of 5-fluorocytosine (5-FC, Sigma-Aldrich, UK) at 48 mM and 2.5 nM WR99210 for a week ...
-
bioRxiv - Cell Biology 2024Quote: ... blots were blocked 1 h at room temperature (RT) with 5% non-fat dry milk (Carl Roth, T145.2) or 5% bovine serum albumin (BSA, Sigma-Aldrich, A7906) in TBS-Tween (0.5 M Tris ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for one hour at room temperature in 5% dry milk (Sysco, 5398953) dissolved in TBST (500 mM Tris, 1.5 M NaCl, 0.1% Tween20 [Sigma, 9005-64-5]) followed by overnight incubation with primary antibodies at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... diluted 1:20 in paraffin oil (CAS: 042-47-5, AppliChem) and 1-octanol (OCT, undiluted; CAS: 111-87-5, Sigma Aldrich) were used ...
-
bioRxiv - Neuroscience 2023Quote: Medium was exchanged with a 5:1 mixture of pre-warmed culture medium and 5 mg/ml MTT (Sigma-Aldrich, M5655) in PBS for a total volume of 120 µl ...
-
bioRxiv - Biochemistry 2023Quote: ... Labeling was carried out at room temperature for 2 hours with end-to-end rotation and quenched with 5 µL of 5% hydroxylamine (Sigma Aldrich) for 15 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were blocked for 1 hour at room temperature in 5% (w/v) non-fat milk (Marvel) or 5% (w/v) BSA (Sigma-Aldrich) depending on the antibody specifications ...
-
bioRxiv - Developmental Biology 2023Quote: RNA extraction of 7 dpf larvae (5 dpf +2 days of drug treatment) in batches of 5 individuals was performed using TriZol reagent (Sigma-Aldrich) and RNA purification kit (Zymo) ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... were superovulated by injecting them with pregnant mare serum gonadotropin (5 IU, Prospec) and human chorionic gonadotropin hormone (5 IU, Sigma-Aldrich) intraperitoneally at 48-h intervals ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated for 10 min at room temperature or directly washed by centrifugation at 5,000×g for 5 min and resuspension in 5 µl of 1×PBS supplemented with 0.2 µg/ml propidium iodide (PI) (Sigma-Aldrich P4170). Cells were placed on a 1% agarose pad that was supplemented with either 0.2% arabinose or both 0.2% arabinose and 0.1 mM IPTG ...
-
bioRxiv - Biochemistry 2022Quote: ... Pellets were resuspended in lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgSO4, 5 mM 6-aminocaproic acid (Sigma, cat. #A2504), 5 mM benzamidine (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Ultrathin sections of 50 nm were blocked with 5% FBS/5% NGS for 30 minutes and subsequently incubated with mouse anti-FLAG (Sigma F3165) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... The bacterial DNA was used to amplify the entire 16S region by PCR [5′-AGAGTTTGATCCTGGCTCAG-3′ (forward) and 5′-AAGGAGGTGATCCAGCCGCA-3′ (reverse)] using Expand High-Fidelity Polymerase (Sigma-Aldrich). The PCR products were purified using the QIAquick PCR Purification kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were washed three times with PBS for 5 min and blocked with 5% of donkey serum or 5% of goat serum in PBS with 0.5% Triton-X (93443, Sigma, Darmstadt, Germany). Primary antibodies were added overnight at 1:100 for CD31 (AF3628 ...
-
bioRxiv - Physiology 2023Quote: ... The percentage of apoptotic cells was determined using the DNA-binding dyes propidium iodide (PI, 5 μg/ml) and Hoechst 33342 (HO, 5 μg/ml, Sigma-Aldrich) as previously described ...
-
bioRxiv - Physiology 2023Quote: ... and endothelium-dependent and -independent vasorelaxation responses were determined with acetylcholine (10-9 to 10-5 mol/L) and sodium nitroprusside (10-9 to 10-5 mol/L) respectively (Sigma-Aldrich).
-
bioRxiv - Microbiology 2023Quote: ... The relative msfGFP measurements were normalised for their respective OD600 values and subsequently converted to absolute units of the calibrant 5(6)-carboxyfluorescein (5(6)-FAM)) (Sigma-Aldrich). Finally ...
-
bioRxiv - Immunology 2023Quote: ... and maintained at 37°C with 5% CO2 in complete RPMI in the presence of 5% human AB serum (Sigma-Aldrich) for differentiation into MDMs for 10-14 day (Pierini et al. ...
-
bioRxiv - Immunology 2023Quote: ... cells were fixed for 10 minutes with PFA 5% and permeabilised for 5 minutes with 0.1% saponin in PBS (Sigma Aldrich, USA) and then blocked with PBS-FBS 2% before the staining ...
-
bioRxiv - Molecular Biology 2023Quote: ... permeabilized with 0.25%Triton X-100/PBS for 15 min and blocked for 1 h at RT with 5% NGS (Jackson Immuno Research, 005-000-121) + 5% BSA (Sigma, A2153). The following primary antibodies were used ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ug protein samples were boiled at 90°C for 5 minutes in LDS sample buffer (Genscript#M00676 or Millipore#MPSB) containing 5% 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in 5 units/μl of DNA polymerase in diluted Polymerase Buffer with Red Fluorescent-labeled Oligonucleotides (1:5, Sigma Aldrich) for 100 minutes at 37 °C ...
-
bioRxiv - Biophysics 2024Quote: Adenosine 3’,5’-cyclic monophosphate sodium salt monohydrate (cAMP) and guanosine 3’,5’-cyclic monophosphate sodium salt (cGMP) were purchased from Sigma Aldrich and both prepared at 16 mM in 150 mM KCl ...
-
bioRxiv - Microbiology 2024Quote: ... HEK 293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (5’-CAACAAGATGAAGAGCACCAA-3’) or ATF4-targeted shRNA (5’-GCCTAGGTCTCTTAGATGATT-3’) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Neuroscience 2021Quote: The microglia were plated at a density of 5 × 10 5 cells /cm2 and treated with either IFN-γ (50 ng/mL, Sigma, SRP3211), IL-4 (20 ng/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were subcultured onto glass coverslips (hand-cut to ∼5 x 5 mm) coated with 0.1 mg/mL Poly-D-Lysine (Millipore-Sigma, #27964-99-4) in 35-mm cell culture dishes (Corning ...
-
bioRxiv - Biochemistry 2019Quote: ... Knock-down of glutamate dehydrogenase 2 (GDH2, encoded by the GLUD2 gene) using siRNAs (#NM_012084: 5’CUAACCUCUUCACGUGUAA’3 and 5’UUACACGUGAAGAGGUUAG‘3, Sigma-Aldrich, Taufkirchen, Germany) or transfection of GLUD2 plasmid/empty vector controls was done using Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by 3x PBS washes for 5 minutes at RT before blocking with blocking buffer (BB; 5% normal donkey serum Sigma-Aldrich #S30-M, 3% BSA (Sigma #A4503) and 0.25% Triton-X100 (Sigma #T9284 ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...