Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 4 Amino 3 8 dichloro 5 methoxyquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Cancer Biology 2022Quote: ... spheroids were treated with 7.5mM 3-MCPD over 8 days (Sigma-Aldrich). RFP (625-705nm ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by two washes with 3 % BSA (Sigma-Aldrich, 9048-46-8). For labeling ...
-
bioRxiv - Neuroscience 2020Quote: The MEK inhibitor α-[amino[(4-aminophenyl)thio]methylene]-2-(trifluoromethyl)benzeneacetonitrile (SL327) (Sigma-Aldrich) was dissolved in a vehicle solution of 2.5% dimethyl sulfoxide (DMSO)/ 2.5% Cremophor EL saline solution at 30 mg/kg (Satoh et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated with nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrates (Sigma-Aldrich) in NTM (100mM NaCl ...
-
bioRxiv - Biochemistry 2020Quote: ... and the blotting signals were chemically visualized with either the nitro-blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate (NBT/BCIP) chromogenic assay (Sigma) or infrared scanner ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1 mg/mL X-Gal (5-Bromo-4-chloro-3-indolyl-β-D-galactopyranoside, Sigma Aldrich Aldrich, St. Louis, MO), and 150mM NaCl ...
-
bioRxiv - Bioengineering 2021Quote: ... we incubated them with suspended lentiviral solutions (MOI 3-5) for 24 h with 4 µg/mL polybrene (Sigma-Aldrich) before we replaced the medium with refresh culture medium ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated in B2 with 2% nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP, Sigma) until adequate colour development ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... coli DH5α cells were transformed with the resulting pho-lac fusion plasmids and streaked on dual indicator plates containing LB agar with 5-bromo-4-chloro-3-indolyl phosphate disodium salt (X-Phos) (Sigma) at a final concentration of 80μg/ml and 6-chloro-3-indolyl-β-D-galactoside (Red-Gal ...
-
bioRxiv - Microbiology 2021Quote: ... Immunoreactive bands were detected by the addition of BCIP (5-bromo-4-chloro-3-indolylphosphate)-nitroblue tetrazolium solution (Sigma-Aldrich). The reaction was stopped after 2 min by washing the blots with large volumes of deionized water.
-
bioRxiv - Bioengineering 2021Quote: ... slides were either treated with SIGMA FAST™ BCIP/NBT (5-Bromo-4-chloro-3-indolulphosphate/Nitro blue tetrazolium, pH 9.5, Sigma) and counterstained with nuclear fast red (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... Color was developed with freshly prepared 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT; Sigma-Aldrich) and the reaction was stopped by addition of 2 mM ethylenediaminetetraacetic acid (EDTA).
-
bioRxiv - Cancer Biology 2021Quote: ... after 72 hours of drug treatment, 20μl of a 5mg/mL 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (M2128-MTT; Sigma-Aldrich, USA) solution was added to each of the wells ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418; Sigma). The culture was incubated with shaking (120 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: Cytotoxicity of Quercetin and other natural compounds was evaluated using MTT (3-(4, 5- dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide dye) assay (Sigma Aldrich). Following the drug treatment in triplicate at indicated concentrations ...
-
bioRxiv - Neuroscience 2023Quote: ... for 5 minutes and washed 3-4 times in PBS before being mounted in Mowiol mounting media (Millipore, 475904-M).
-
bioRxiv - Neuroscience 2022Quote: ... mito-tempol[23] (25 μg, Sanbio) and oligodeoxynucleotide (3 μg/μl day 4, 5 and 6 after carrageenan, Sigma-Aldrich), were performed under light isoflurane anesthesia as described.[8a ...
-
bioRxiv - Microbiology 2023Quote: ... the blots were washed again using TBST and developed using AP-reactive Nitrobluetetrazolium (NBT) 5-bromo-4-chloro-3-indolylphosphate (BCIP) tablets (Sigma). A final image of the blots was taken on a Bio-Rad ChemiDoc gel imaging system using colorimetric detection.
-
bioRxiv - Developmental Biology 2024Quote: ... the samples were incubated in NBT (nitro-tetrazolium blue)-BCIP (5 bromo-4-chloro-3’-indolyphosphate p-toluidine) (Sigma-Aldrich), 0.033% in APTMg in dark condition ...
-
bioRxiv - Immunology 2021Quote: ... or 0.5 μM/ml 5-amino-6-D-ribitylaminouracil (5-A-RU) (courtesy of Jeffrey Aubé, UNC) and 50 μM/ml Methylglyoxal (Sigma). Brefeldin A Solution (Biolegend ...
-
bioRxiv - Biophysics 2021Quote: ... The bottom coverslip was functionalized with an amino-group in the 2% 3-aminopropyltheithoxysilane (440140, Sigma) in acetone for 10 min ...
-
bioRxiv - Genetics 2023Quote: ... Fish were anaesthetised for live imaging using Tricaine methanesulfonate (3-amino benzoic acidethylester; Sigma Aldrich, E10521) at a final concentration of 0.016% in E3 embryo medium (5 mM NaCl ...
-
bioRxiv - Cell Biology 2024Quote: ... For transcriptional inhibition cells were treated with 2.5 µg/ml actinomycin D or 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole (DRB) (both Sigma). For inhibition of arginine methylation ...
-
bioRxiv - Molecular Biology 2021Quote: ... X0-3 and X0-4 oligonucleotides (Sigma-Aldrich) in a buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µM 4-hydroxytamoxifen (OH-Tam, Sigma Aldrich) was added to induce Cre-mediated recombination in the mouse Ctsd gene resulting in a premature stop codon ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3 and 4 were custom made from Sigma in the pLKO.1-Puro-CMV-tGFP vector backbone ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 ng/mL human NT-3 (Sigma-Aldrich), and 1 μg/mL laminin (Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... 4-methylcyclohexanol (CAS #589-91-3, Millipore Sigma), pentyl acetate (CAS #628-63-7 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 mM glyceraldehyde-3-phosphate (G3P; Sigma-Aldrich), 4 mM nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’-GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’-AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Bioengineering 2021Quote: ... they were anaesthetized in 3-amino benzoic acid ethyl ester (Tricaine/ethyl 3-aminobenzoate; Sigma Aldrich; 168 μg·ml−1 in Tris pH 7) and embedded in 1% low melting point agarose (UltraPure Agarose ...
-
bioRxiv - Genetics 2023Quote: ... and 100µM 4-(3-butoxy-4-methoxy-benzyl) imidazolidone (Ro20-1724, Sigma Aldrich). IBMX and imidazolidone act as phosphodiesterase inhibitors ...
-
bioRxiv - Cell Biology 2022Quote: ... BubR1 5’GAUGGUGAAUUGUGGAAUAdTdT3’) or luciferase (5’ CGUACGCGGAAUACUUCGAdTdT 3’) was synthesized from Sigma and used for the RNAi.
-
bioRxiv - Cancer Biology 2023Quote: ... Where indicated an RGD peptide (sequence - Acetyl-Cys-Doa-Doa-Gly-Arg-Gly-Asp-Ser-Pro-NH2; Doa = 8-amino-3,6-dioxaoctanoic acid, Millipore Sigma) was added to the cell suspension at a concentration of 0.5 mM ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 8 μM hemin (4 mM stock made in 50% triethanolamine) (Sigma, USA), 25mM Hepes (N-[2-hydroxyethyl]piperazine-N0-[2-ethanesulfonic acid ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatment with HU (Sigma-Aldrich, 0, 0.5, 1, 2, 4, 8 mM) was for 24h ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...