Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for 4 Amino 3 8 dichloro 5 methoxyquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... 8 µL of 4% (v/v) ‘light’ (Sigma Aldrich, F1635) or ‘heavy’ formaldehyde-13C ...
-
bioRxiv - Microbiology 2022Quote: ... 3 days post-infection 4 mL of paraformaldehyde 4% (#158127, Sigma) was added and incubated overnight at 4ºC ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (Sigma-Aldrich, Oakville, cat# 9048-46-8,), and 0.05% Triton X-100 in PBS for 1 h at room temperature (RT) ...
-
bioRxiv - Microbiology 2023Quote: ... 8% polyacrylamide gel containing 0.5% 3- (Acrylamido) phenylboronic acid (Sigma-Aldrich) after resuspending in a 2X RNA Loading Dye (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mg of 4-OHT (Sigma H7904) were dissolved in 120μl of ethanol ...
-
bioRxiv - Immunology 2022Quote: ... We used 3-4 synthetic sgRNAs (Sigma) per gene ...
-
bioRxiv - Microbiology 2023Quote: ... 4-azidobenzoic acid (6427-66-3, Sigma), propidium iodide powder (25535-16-4 ...
-
bioRxiv - Biochemistry 2021Quote: The competitive inhibition of human fumarase activity in the presence of 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910) was fluorometrically assessed using a coupled enzyme assay ...
-
bioRxiv - Cancer Biology 2019Quote: WT and DCLK1+ cells were plated at 3 x 10^5 cells/well into 8-well Millicell EZ chamber slides (Millipore, cat. no. PEZGS0816) overnight ...
-
bioRxiv - Bioengineering 2020Quote: ... Embryos were anesthetized with tricaine (3-amino benzoic acidethylester, 0.2 mg/mL, Sigma Aldrich, MO), embedded in 1% low-melting-point agarose ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were resuspended in SC media containing 15 mM 3-amino-1,2,4-triazole (3AT; Sigma) and 5 µg/ml α-factor (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... The plates were developed with commercially available 3-Amino-9-ethylcarbazole (AEC) substrate (Sigma-Aldrich). The observed spots were counted using an ELISPOT plate reader by ZellNet and the final data was reported as spot forming cells (SFC ...
-
bioRxiv - Cell Biology 2023Quote: ... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...
-
bioRxiv - Immunology 2021Quote: ... 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium (BCIP /NBT) liquid substrates for AP-enzyme (SIGMA) were added for overnight incubation at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol-4’,5’-bisphosphate) (ammonium salt) (PI(4,5)P2) (Sigma 850155P), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC ...
-
bioRxiv - Physiology 2020Quote: The reduction of yellow tetrazolium salt 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich, Germany) was used to measure cellular metabolic activity as a proxy for cell viability [19,22] ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 40ul of 20mg/mL X-gal (5-bromo-4-chloro-3-indolyl-β-D-galacto-pyranoside – Sigma Aldrich B44252) and 40ul of 100mM IPTG (isopropyl β-D-1-thiogalactopyranoside – AppliChem A4773 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 mM MgCl2 6 H2O and 5-Bromo-4-chloro-3-indolyl β-D-galactoside or X-gal (Sigma, B4252 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The unbroken cells were removed by centrifugation (3,000 x g; 4°C; 5 min; Sigma 3-16KL; rotor 11180). The membrane fraction was pelleted down by high-speed centrifugation (100,000 x g ...
-
bioRxiv - Biophysics 2019Quote: ... The eluate was incubated for 3 h at 4°C with 5 mL of FLAG M2 Agarose beads (Sigma), collected in a glass column ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 250 µL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) (20 mg/ml) (Sigma-Aldrich, UK) and Isopropyl ß-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell disruption was carried out by vortexing (3 cycles, 5 min each) at 4°C using 0.2 ml of glass beads (425-600 μm; Sigma). For the Rpb3 immunopurification ...
-
bioRxiv - Cell Biology 2022Quote: ... was revealed with 5-bromo-4-chloro-3-indolyl β-D galactoside (X-gal) (Sigma-Aldrich, Carlsbad, CA, USA). Diploid cells were grown on SC medium supplemented with 20 mg/L adenine hemisulfate ...
-
bioRxiv - Cell Biology 2023Quote: The cell proliferation assay was determined by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay (Sigma). All cancer cell lines were seeded in 24-well plates (2×104 cells/well) ...
-
bioRxiv - Microbiology 2024Quote: ... Coloring reactions were performed with nitro blue tetrazolium/5-Bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) solution (Sigma), and then sections were washed in PBS ...
-
bioRxiv - Microbiology 2019Quote: ... A 200 μL aliquot of a solution containing 100 μg/μL of XTT (2, 3-(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide) (Sigma-Aldrich, St Louis, MO, USA) and 10 μg/μL of PMS (phenazine methosulfate ...
-
bioRxiv - Biochemistry 2019Quote: ... Cell pellets were resuspended in PBS and mixed with the equal volume of lysis buffer (3 M NaCl, 100 mM Tris-HCl pH 7.5, 4 mM EDTA pH 8, 20 mM ß-mercaptoethanol, Sigma Protease Inhibitor Cocktail (Sigma)) ...
-
Neural interactions in developing rhythmogenic spinal networks: Insights from computational modelingbioRxiv - Neuroscience 2020Quote: ... and serotonin creatinine sulfate monohydrate (5-HT, 8 μM, Sigma). The gap junction blocker carbenoxolone (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM, Sigma) was dissolved in DMSO at 4 mg/ml as stock solution and diluted 20 times using a buffer containing 25 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... 1µM 4-hydroxy 5-methytetrahydrofolate (SIGMA).
-
bioRxiv - Molecular Biology 2022Quote: ... IL-4 (5 ng/ml; Sigma) 0.5 μg/ml of anti-CD180 (RP105 ...
-
bioRxiv - Immunology 2023Quote: ... 4 μl betaine (5 M, Sigma), 0.12 μl MgCl2 (1 M ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-OHT (5 µM; Sigma-Aldrich), Dp44mT (5 μM) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 ng/mL IL-4 (Sigma), and 0.5 ug/mL anti-CD180 (BD Pharmingen ...
-
bioRxiv - Genomics 2021Quote: ... A single colony was transferred to 5 mL YNB without amino acids (Sigma Y1250) prepared according to the manufacturer’s instructions plus 2% glucose ...
-
bioRxiv - Neuroscience 2021Quote: ... 2,5-dimethoxy-4-iodoamphetamine (DOI, 8 mg/kg, Sigma-Aldrich, USA) or vehicle (0.9% NaCl ...
-
bioRxiv - Neuroscience 2019Quote: ... Adult zebrafish were assayed for response to a mixture of 8 amino acids (Ala, Cys, His, Lys, Met, Phe, Trp, and Val; 0.1 mM each in distilled water; Sigma). No stimulation was provided for the first 5 mins following which the amino acid mix was introduced in one side of the tank at the rate of 1 ml/min using a syringe pump ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 3-MA (M9281, Sigma), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Biochemistry 2021Quote: ... 5(6)-carboxyfluorescein (3 eq, Sigma-Aldrich) was activated with PyAOP (3 eq ...