Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for 4 Amino 3 8 dichloro 5 methoxyquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... it was added the substrate 3-Amino-9-ethylcarbazole (AEC) (Sigma-Aldrich), for 20 minutes ...
-
PD-1 checkpoint blockade disrupts CD4 T cell regulated adaptive B cell tolerance to foreign antigensbioRxiv - Immunology 2021Quote: ... and developed with chromogen substrate: 0.03% 3-amino-9-ethylcarbazole (Sigma-Aldrich) and 0.015% H2O2 in 1M sodium acetate ...
-
bioRxiv - Molecular Biology 2020Quote: ... binding was visualized using 3-amino-9-ethylcarbazole (AEC) (Sigma-Aldrich, Germany) and slides were counterstained using hematoxylin.
-
bioRxiv - Immunology 2020Quote: ... and 3’-amino-9-ethyl carbazole (AEC Tablets, Sigma, St. Louis, MO) were further used to develop the plate ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 mM or 30 mM 3-amino-1,2,4-triazole (3AT, Sigma-Aldrich). Growth was scored after 4 days of growth at 30°C.
-
bioRxiv - Immunology 2021Quote: ... plates were developed using 3-amino-9-ethyl-carbazole (AEC) substrate (Sigma). The developed plates were scanned ...
-
bioRxiv - Immunology 2021Quote: ... plates were developed using 3-amino-9-ethyl-carbazole (AEC) substrate (Sigma). The developed plates were scanned and spots were analyzed using an automated ELISpot counter (Cellular Technologies Ltd.).
-
bioRxiv - Molecular Biology 2023Quote: ... binding was visualized using 3-amino-9-ethylcarbazole (AEC) (Sigma-Aldrich, Germany) and slides were counterstained using hematoxylin.
-
bioRxiv - Cell Biology 2023Quote: ... is diluted in DMSO and 3-Amino-propionitril -fumarat (BAPN, Sigma, A3134) is diluted in H2O ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Microbiology 2019Quote: ... and primers p181 (5’-GCGAAGATAACAGTGACTCTA-3’ and p54 (5’-CGGCTCTGATTAAATTCTGAAG-3’) (Sigma, UK).
-
bioRxiv - Immunology 2022Quote: ... 4 μl or 8 μl of Benzonase (Millipore) was added to the FoxP3 and Runx1 mixture for 10 minutes at 25 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were fed by dichloro-dihydro-fluorescein diacetate (DCFH-DA)(D6883, Sigma-Aldrich) for 60 min in fresh DMEM media ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transcription inhibitor 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole (DRB) powder (Millipore Sigma, D1916-50MG) was dissolved in DMSO for a final stock concentration of 100mM ...
-
bioRxiv - Cell Biology 2024Quote: ... and the transcription elongation inhibitor 5,6-dichloro-1-ß-D-ribofurosylbenzimidazole (DRB; Sigma-Aldrich). The final concentrations of the drugs used were 0.4 aphidicolin ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pellets were resuspended at an OD600 of 1 in 5 ml of agroinfiltration buffer (10 mM MgCl2 and 250 μM of 3’,5’-Dimethoxy-4’-hydroxyacetophenone (Sigma-Aldrich)) ...
-
bioRxiv - Neuroscience 2020Quote: ... were performed in DJ-1-deficient cells with MTT (3-(4, 5-dimethylthiazol-2-yl)−2–5-diphenyltetrazolium bromide) (Sigma-Aldrich) as described in [24] ...
-
bioRxiv - Immunology 2020Quote: ... Mice were subjected to cutaneous immune challenge by applying 20 µl of 3-5% 4- Ethoxymethylene-2-phenyl-2-oxazolin-5-one (Sigma-Aldrich) in 1:2 acetone:olive oil ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μl of 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT, 0.5 mg/ml in PBS, Sigma-Aldrich, USA) with 1 μM of menadione (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... mosquitoes were kept at 26.0°C (± 0.5°C) in an ultrasonic humidity cabinet and provided with 8 % Fructose and 0.05 % 4-Aminobenzoic acid (both Sigma) feeding solution from this point forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4% 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS, Sigma)] ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 μl of 8 mg/ml hexadimethrine bromide (Sigma) was added to each well ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 µl of 8 mg/ml hexadimethrine bromide (Sigma) was added to each well ...
-
bioRxiv - Cell Biology 2020Quote: ... washed and developed with chromogenic 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, Sigma-Aldrich, B6149).
-
bioRxiv - Plant Biology 2021Quote: ... Blots were developed using nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma Argentina).
-
bioRxiv - Genetics 2019Quote: BzATP (2′(3′)-O-(4-Benzoylbenzoyl) adenosine 5′-triphosphate triethylammonium salt) was purchased from Millipore Sigma and ...
-
bioRxiv - Neuroscience 2024Quote: ... D-APV (D-(-)-2-amino-5-phosphonvaleric acid) (30 μM, Sigma), Gabazine (10 μM ...
-
bioRxiv - Cell Biology 2022Quote: The tissue section on the Stereo-seq chip (5 cm x 3 cm or 2 cm x 3 cm) was then incubated at 37°C for 5-8 min and subsequently fixed in methanol (Sigma, 34860 ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction was stopped by the addition of 28 μl of a stop reaction mixture: 3 μl of the reducing reagent (mixture of 0.2 g 1-amino-2-naphtol-4-sulfonic acid (Millipore-Sigma, Burlington, MA, USA, #08751) with 0.2 g sodium bisulfite (Millipore-Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-fluorouracil (5-FU) : 3 µM (F6627; Sigma), cisplatin (CDDP ...
-
bioRxiv - Plant Biology 2019Quote: ... The transformants were then spotted on SD (-Trp -Leu -His) selection media containing 0.5/1mM 3-Amino-1,2,4-triazole (3-AT; Sigma, A8056). The positive interactors were then scored based on the stringency of the selection.
-
bioRxiv - Cell Biology 2022Quote: ... and 3-Amino-1,2,4-triazole (3-AT) (≥95% TLC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Z-VAD-FMK ...
-
bioRxiv - Genetics 2022Quote: ... Positive interactions were scored by the appearance of white-coloured colonies on a synthetic defined medium containing 6 μg mL−1 adenine and/ or by the growth in presence of 2 mM 3-Amino-1,2,4-triazole (3-AT) (A8056, Sigma).
-
bioRxiv - Plant Biology 2024Quote: ... Bromo-4-Chloro-3-Indolyl a-D-galactopyranoside (X-a-gal) and 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma). The plates were imaged after 60-72 incubation at 28°C ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Genetics 2020Quote: ... Samples were immunoprecipitated with S9.6 antibodies (8 μ antibody/ 5μ DNA) overnight at 4°C followed by incubation for 3 hours with protein G-Sepharose beads (Millipore) and washed sequentially ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 8-hydroxy-5-quinolinecarboxylic acid (Sigma-Aldrich; SML0057), S-(5′-Adenosyl)-L-homocysteine (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 mM NaCl (Sigma-Aldrich, 7647-14-5), 10 mM HEPES ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-8 μg/ml of polybrene (Sigma Aldrich) was supplemented in the media ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Biophysics 2020Quote: ... the larvae were anesthetized with tricaine (3-amino benzoic acidethylester, Sigma Aldrich, MO) and immobilized in 1% low-melting-point agarose inside FEP (Fluorinated Ethylene Propylene ...
-
bioRxiv - Plant Biology 2022Quote: ... The basal medium also contained 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma) for selection ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were developed using 3,3’-diaminobenzidine or 3-amino-9-ethyl carbazole (Sigma) and counterstained with hematoxylin.
-
bioRxiv - Genetics 2021Quote: ... Mouse neural progenitor cells were routinely passaged 1:2-1:4 every 3-5 days using Accutase and maintained in NS expansion medium on laminin-coated plates (Sigma, 3 μg/ml). Both mESCs and mNPCs were incubated at 37 °C and 5% CO2 ...
-
bioRxiv - Biochemistry 2022Quote: ... The imaging glass coverslip surface was treated with dichloro dimethyl silane26 (DDS) (Sigma-Aldrich:440272) and further passivated with 2 mg/ml Bovine serum albumin (BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... The samples were incubated with 20 µM dichloro-dihydro-fluorescein diacetate (DCFH-DA) (Sigma-Aldrich) at 37 °C for 1 hour ...
-
bioRxiv - Microbiology 2019Quote: ... MH agar was supplemented with 100 μg/mL XS (5-bromo-4-chloro-3-indolylsulfate (Sigma-Aldrich)) with or without 0.35 μg/mL anhydrotetracycline (ATc ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
bioRxiv - Molecular Biology 2019Quote: ... in second attempt we used the library consisted of 8 random nucleotides with fixed G in the middle position: 5’-GCTCAAGCTTACTGCAGATATNNNNGNNNNTTTAGGATCCATCTAGAGTCCGA- 3’(SIGMA-ALDRICH). 15µg of the library were made double-stranded with 5µg 3’ primer (CAST1_R- ACTCTAGATGGATCCTACG or CAST2_R-TCGGACTCTAGATGGATCCTA ...
-
bioRxiv - Cancer Biology 2023Quote: Dissected tumors were washed in PBS and homogenized at room temperature in urea lysis buffer (8 M urea, 40 mM Tris pH 7.6, 5% SDS supplemented with phosphatase inhibitor cocktails 2, 3 (Sigma P5726, P0044)) ...