Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 1 2 Bromoethoxy 3 5 dimethylbenzene 97+% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... beads were rewashed 3 times 5 minutes with 1× wash buffer (Sigma-Aldrich, W0390) on a rotator and with protease and phosphatase inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... from QIAGEN or costume siRNA against MdmX (siMdmX#1, sequence: 5’-AGAUUCAGCUGGUUAUUAA-3’) from Sigma-Aldrich. For Spry4 knockdown cells were transfected with a pool of 3 siRNAs against Spry4 (s37824 ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Biochemistry 2021Quote: ... 5(6)-carboxyfluorescein (3 eq, Sigma-Aldrich) was activated with PyAOP (3 eq ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Microbiology 2024Quote: ... 3-Methyladenine (5 mM, Millipore Sigma, M9281), lactostatin (1 µM ...
-
bioRxiv - Bioengineering 2022Quote: ... Trichloro (1H,1H,2H,2H-perfluorooctyl) silane (97%) and the 1H,1H,2H,2H-Perfluorodecanethiol (97%) were purchased from Sigma Aldrich Co ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Plant Biology 2020Quote: ... and anti-α-tubulin antibodies (clone B-5-1-2, Sigma-Aldrich) at 1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: ... α-Tubulin (T5168, Clone B-5-1-2) was from Sigma Aldrich.
-
bioRxiv - Biochemistry 2021Quote: A monoclonal anti-α-tubulin (SIGMA, T5168, Clone B-5-1-2) was used in western blots as a loading control ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mg·ml-1 iodoacetamide and 5 U/l Salt Active Nuclease (Sigma) for 1 h at 4 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cells were also treated with 1 μM 5-Aza-2’-deoxycytidine (Sigma) or 100 nM chaetocin (Cayman Chemical) ...
-
bioRxiv - Immunology 2022Quote: ... or α-Tubulin (clone B-5-1-2, Sigma-Aldrich, Cat#T5168). Primary antibodies were revealed with IRDye® 680 Goat anti-Mouse IgG or IRDye® 800CW Goat anti-Rabbit IgG (LI-COR ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti-α-tubulin B-5-1-2 monoclonal primary (T5168, Sigma), followed by goat-anti mouse IRDye 680 goat anti-mouse IgG secondary antibodies (926-68070 ...
-
bioRxiv - Neuroscience 2022Quote: ... atipamezole (a α2-AR antagonist: 100 μg; Sigma-Aldrich, Gillingham, United Kingdom, dissolved in 97% normal saline, 2% Cremophor [Sigma, UK] ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5% 2-mercaptoethanl (Sigma) by incubating the beads at 100°C for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 5% 2-mercaptoethanol (Sigma) and fractionated by SDS-PAGE using the Mini-PROTEAN Tetra System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol (Sigma), and incubated at room temperature instead of boiled ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2/3 mTeSR1 + 1/3 N2 medium + LSX + PSD Day 6,7: 1/3 mTeSR1 + 2/3 N2 medium + PSD At day 6 cells were detached by Accutase solution (Sigma-Aldrich) and incubated at 37°C for 20 minutes to obtain a single cell suspension ...
-
bioRxiv - Cell Biology 2023Quote: ... except the protein sample was concentrated to 4 mg/ml and mixed with 0.005% 3-([3-Cholamidopropyl]dimethylammonio)-2-shydroxy-1-propanesulfonate (CHAPSO; Sigma Aldrich) immediately before vitrification ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-α-tubulin (1:2,000; clone B-5-1-2, Sigma-Aldrich, cat. # T5168) and mouse anti-MIC2 (1:2500 ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Molecular Biology 2024Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’- GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’- AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Genomics 2023Quote: ... then quickly was cut to small pieces (1-3 mm) in petri dish with 3 -5 ml RMPI medium containing 0.05mg/ml TM Liberase (Sigma Aldrich, 5401119001) and 0.02 mg/ml DNAaseI (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.05% Tween-80 at OD600 of 0.05 with two-fold serial dilutions of POA (pyrazinecarboxylic acid; Millipore-Sigma, 98-97-5). Where indicated ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μM 5-bromo-2’-deoxyuridine (BrdU, Sigma-Aldrich) was added into the culture medium for 10 h ...
-
bioRxiv - Genomics 2020Quote: ... 5-aza-2’-deoxycytidine (5-aza-dC, Sigma, A3656) was diluted in DMSO at a concentration of 10mM and Abl.1 cells were treated using a concentration range of 10 nM to 20 μM 5-aza-2’-deoxycytidine ...
-
bioRxiv - Microbiology 2023Quote: ... The Benin 97/1 isolate was cultured in porcine bone marrow (PBM) cells in EBSS (Sigma), supplemented with 4mM Hepes ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.1% w/v Ferrozine (Disodium-4-[3-pyridin-2-yl-6-(4-sulfonatophenyl)-1,2,4-triazin-5-yl]benzosulfonate (Sigma-Aldrich) in dd ...
-
bioRxiv - Physiology 2020Quote: The reduction of yellow tetrazolium salt 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich, Germany) was used to measure cellular metabolic activity as a proxy for cell viability [19,22] ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 mM MgCl2 6 H2O and 5-Bromo-4-chloro-3-indolyl β-D-galactoside or X-gal (Sigma, B4252 ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mg/ml of 3-(4,5-Dimethyl-2-thiazolyl-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, San Louis, MI, USA) solution in PBS was added to the cells and incubated for an additional 4 h ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were incubated with 5 mg/mL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma Aldrich) in PBS for 15 min at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mg/ml of 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MI, USA) solution was applied to the cells and incubated for an additional 4h ...
-
bioRxiv - Microbiology 2023Quote: ... 30 μL of MTT [(3- [4,5-dimethyl-2-thiazolyl] -2,5-diphenyl-2H-tetrazolium bromide; 5 mg/mL; (Sigma-Aldrich)] was added in each well and the plate incubated for 3 hours at 25°C ...
-
bioRxiv - Cell Biology 2024Quote: ... After blocking of endogenous peroxidases (3% H2O2) and unspecific antibody binding (2% BSA+5%serum) PLAC8 antibody (HPA040465, Sigma) or SARS-CoV-2 Spike Glycoprotein S1 antibody (GTX632604 ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mg/ml of 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MI, USA) solution was added to the cells and incubated for an additional 4 h ...
-
bioRxiv - Cell Biology 2023Quote: The cell proliferation assay was determined by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay (Sigma). All cancer cell lines were seeded in 24-well plates (2×104 cells/well) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Fixed embryos were washed 3 times (5 minutes each) in wash buffer DPBS Tween containing 2% BSA (Sigma, A3311), and permeabilised at room temperature for 20 minutes in permeabilisation buffer 0.5% Triton-X in DPBS ...
-
bioRxiv - Cancer Biology 2023Quote: Culture medium was replaced with 100 µL medium containing 5 mg/mL filtered 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (#M5655, Sigma-Aldrich) and incubated for 2 h at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... media was aspirated from cells and replaced with 5 mg/mL 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, #M5655, Sigma Aldrich) solution in base media ...