Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 1 2 Bromoethoxy 3 5 dimethylbenzene 97+% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Biochemistry 2024Quote: The DNA used in the crystallization of the NtcA-2OG-DNA complex was prepared by 10-min heating at 65°C of an equimolar mixture of the synthetic oligodesoxyribonucleotides 5’-AGCTGATACATAAAAAT-3’ and 5’-CATTTTTATGTATC-3’ (from Sigma) in 5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pellets were resuspended at an OD600 of 1 in 5 ml of agroinfiltration buffer (10 mM MgCl2 and 250 μM of 3’,5’-Dimethoxy-4’-hydroxyacetophenone (Sigma-Aldrich)) ...
-
bioRxiv - Neuroscience 2021Quote: ... atipamezole (a α2-AR antagonist: 10 and 100 μg; Sigma-Aldrich, Gillingham, United Kingdom, dissolved in 97% normal saline, 2% Cremophor [Sigma, UK] ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 5% fetal bovine serum (FBS) and 1 ng/ml fibroblast growth factor-2 (FGF-2; Millipore). Cells were grown in tissue culture treated 24 well plates and 5% CO2 at 37°C.
-
bioRxiv - Biophysics 2020Quote: ... samples were incubated with 2 % (v/v) primary anti-tubulin antibody (clone B-5-1-2, Sigma-Aldrich) in blocking buffer for 60 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Biochemistry 2024Quote: ... 60 nM siZWINT (Sigma-Aldrich, 5’-GCACGUAGAGGCCAUCAAA-3’) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... An annealed primer (5’-CGCGUAGCAUGCUACGUCAUUCUCCUAAGAAGCUG-3’) (Millipore Sigma) and template (5’-CUAUCCCCAUGUGAGCGGCUCAGCUUCUUAGGAGAAUGACGUAGCAUGCUACG CG-3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse α-tubulin clone B-5-1-2 (1:1000; Sigma Aldrich, San Luis, MO, U.S.). For immunofluorescence primary antibodies were labeled with Alexa-conjugated secondary antibodies Alexa 488 ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 1:10000 dilution of anti-mouse alpha-Tubulin (Clone B-5-1-2; SIGMA) for 1 to 3 h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... (B-5-1-2 coupled to Alexa-488, Thermo Fisher or DM1A, Sigma), rat anti-tyrosinated tubulin (YL1/2 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse mAb anti-α-Tubulin (Sigma-Aldrich, clone B-5-1-2, #T5168); mouse mAb anti-Flag M2 (Sigma-Aldrich #F1804) ...
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal anti-alpha-tubulin clone B-5-1-2 antibody (T5168, Sigma-Aldrich) was used as the loading control ...
-
bioRxiv - Immunology 2023Quote: ... or a monoclonal anti-tubulin antibody (Sigma-Aldrich, Clone B-5-1-2). Horseradish peroxidase (HRP)-conjugated anti-rabbit (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2023Quote: ... difficile cultures were supplemented with 2-5 µg thiamphenicol ml-1 (Sigma-Aldrich) for plasmid selection ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing 10 μM EdU and 1 μM 5-fluoro-2’-deoxyuridine (Sigma-Aldrich). Images were acquired with a DeltaVision Elite system and nuclear fluorescence signals quantified using custom software as described(10) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mice were injected with 1 mg 5’-bromo-2’-deoxyuridine (BrdU; Sigma #B9285). Following removal ...
-
bioRxiv - Molecular Biology 2024Quote: ... and monoclonal anti-α-tubulin antibody (clone B-5-1-2, Sigma-Aldrich). After incubation with primary antibodies ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal anti-alpha Tubulin (clone B-5-1-2, Sigma-Aldrich, #T6074), rabbit polyclonal anti-GFP (Origene ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.05% Tween-80 at OD600 of 0.05 with two-fold serial dilutions of POA (pyrazinecarboxylic acid; Millipore-Sigma, 98-97-5). Where indicated ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2-Methoxy-3-methyl-1,4-BQ was synthesized as follows: 2 mmol 2-Methoxy-3-methyl-1,4-hydroquinone (Sigma Aldrich) and 2 mmol NaIO4 were mixed in a 50 ml round-bottom flask and 10 ml CH2Cl2 and 5 ml of water were then added ...
-
bioRxiv - Neuroscience 2020Quote: ... SYSY), vesicular glutamate transporter 2 (VGLUT2; 1:1,000, SYSY) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH, 1:50,000, Millipore) at 4 °C for 16 h ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: PESTANAL® analytical grade tefluthrin (2,3,5,6-tetrafluoro-4-methylbenzyl 3-[(1Z)-2-chloro-3,3,3-trifluoroprop-1-en-1-yl]-2,2-dimethylcyclopropanecarboxylic acid) was purchased from Sigma Aldrich. Tefluthrin stock solutions were prepared in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated in B2 with 2% nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP, Sigma) until adequate colour development ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then stained for 2 minutes at room temperature using filtered 0.5% Solvent Black 3 (CAS Number 4197-25-5; Sigma 199664) dissolved in 75% ethanol ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 µl of a solution of 5 mg/mL MTT [3-(4,5)-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (Sigma Chemical Co.) was added ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were exposed to 5 μM CHIR99021 (Axon) between days 2 and 3 and then supplemented with 100 nM RA (Sigma) until day 5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... after 72 hours of drug treatment, 20μl of a 5mg/mL 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (M2128-MTT; Sigma-Aldrich, USA) solution was added to each of the wells ...
-
bioRxiv - Cell Biology 2021Quote: Confluent ESCs monolayers were decidualized in DMEM/F12 containing 2 % FBS supplemented with 0.3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP) (Sigma-Aldrich, USA), 10 nM β-Estradiol (E2 ...
-
bioRxiv - Genetics 2024Quote: ... differentiation of iPSCs was induced through the Wnt modulation method with 7 μM glycogen synthase kinase 3 b (GSK3b) inhibitor CHIR99021 (Selleckchem) and 5 μM inhibitor of WNT production 2 (IWP2) (Sigma). Basal Media was composed of RPMI media supplemented with B27 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... two to four-month-old mice were gavaged 3 times over 5 days with 2 mg tamoxifen (TX; Sigma #T5648) in corn oil (Sigma #C8267) ...
-
bioRxiv - Molecular Biology 2023Quote: Cytotoxicity of Quercetin and other natural compounds was evaluated using MTT (3-(4, 5- dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide dye) assay (Sigma Aldrich). Following the drug treatment in triplicate at indicated concentrations ...
-
bioRxiv - Bioengineering 2023Quote: ... 3 µL of 2 M CaCl2 and 5 µL of 10 mg/mL ε-aminocaproic acid (ε-ACA) (Sigma-Aldrich), and 1 µL of 1U/µL Thrombin (MP Biomedicals ...
-
bioRxiv - Neuroscience 2023Quote: ... Then the brains were dissected to 2 mm slices and incubated for 10 minutes in freshly prepared 0.5% TTC solution (2, 3, 5-Triphenyltetrazolium chloride, Sigma-Aldrich). Afterward ...
-
bioRxiv - Pathology 2024Quote: ... infiltrated leaves were treated with PBS buffer containing 2% dimethyl sulfoxide (DMSO; control) or an equal volume of DMSO with 5 mM 3-MA (Sigma) for inhibition of autophagy ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then stained for 2 minutes at room temperature using filtered 0.5% Solvent Black 3 (CAS Number 4197-25-5; Sigma 199664) dissolved in 75% ethanol ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA probes (5’-GTTATGAGCCCGACGAGCTACCAGGCTGCT-3’) with a 5’-ethylcarbamate amino linker (Sigma-Aldrich) were covalently immobilized on NHS-activated Sepharose 4 Fast Flow (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: Adult female worms were incubated with 5 μM of 5’ cy3-labeled Bma-lad-2 siRNA 1 (Sigma Aldrich) for 24 hrs to evaluate uptake of siRNA into intestinal tract epithelial cells ...
-
bioRxiv - Neuroscience 2020Quote: ... Bacterial pellets of 20 OD600 units were lysed in 0.5 ml cold lysis buffer (50 mM Sodium-phosphate pH 8.0, 300 mM NaCl, 5% glycerol, 5 mM 2-Mercaptoethanol, 1 mM PMSF [Sigma]), RNase [0.01 mg/ml] ...
-
bioRxiv - Biochemistry 2020Quote: ... Taurocholic acid sodium salt (97% pure) and estrone-3-sulfate sodium salt (containing 35% Tris stabilizer) were purchased from Sigma Aldrich (St. Louis, MO). Rosuvastatin (98% pure ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Biophysics 2021Quote: ... was performed using a pre-annealed DNA-RNA template (DNA45: 5’-TTCTTT ATCTCTTATTTCCTTCTATTTTCCACGCGCCTTCTATTT-3’; RNA13: 5’-[6FAM]-GGCGCGUGGAAAA-3’, Sigma Aldrich). The reaction buffer comprised 25 mM HEPES pH 7.2 ...