Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for 1 2 Bromoethoxy 3 5 dimethylbenzene 97+% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... were reared in 10g/l of glucose/200µM of 3BDO (3-Benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one) (Sigma Aldrich) supplemented in standard fly food ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1% each of phosphatase inhibitor cocktails 2 and 3 (Sigma). Particulate was removed by centrifugation of lysates at 21,000 g for 15 min at 4°C and filtration through 0.45 μm syringe filters ...
-
A Bidirectional Switch in the Shank3 Phosphorylation State Biases Synapses toward Up or Down ScalingbioRxiv - Neuroscience 2021Quote: ... and 1:100 phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich)) and cleared by centrifugation at 20,000 x g ...
-
bioRxiv - Immunology 2021Quote: ... and Phosphatase Inhibitors Cocktail 2 & 3 (1/500, Sigma-Aldrich, Ireland). Following lysis ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1% each of phosphatase inhibitor cocktails 2 and 3 (Sigma)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1% each of phosphatase inhibitor cocktails 2 and 3 (Sigma). Particulate was removed by centrifugation of lysates at 21,000 g for 15 minutes at 4°C and filtration through 0.45 µm syringe filters ...
-
bioRxiv - Cell Biology 2020Quote: ... at 1:1000 dilution and monoclonal antibody B-5-1-2 (Sigma) at 1:1000 dilution to detect α-tubulin as loading control.
-
bioRxiv - Biochemistry 2021Quote: ... α-TUBULIN (ms, clone B-5- 1-2, Sigma T9026, 1:5000), rabbit IgG (gt ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse tubulin (clone B-5-1-2, Sigma, T5168-.2ML; 1/5000), and p21 Waf1/Cip1 (clone 12D1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-Tubulin (1:3,000; Sigma clone B-5-1-2, T5168), and mouse anti-b-Actin (1:1,000 ...
-
bioRxiv - Plant Biology 2024Quote: ... anti-microtubule antibody (1:2,000; clone B-5-1-2; Sigma- Aldrich), and ECL anti-mouse IgG horseradish peroxidase-linked whole antibody (1:1,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... then treated with 1 uM of 5-Aza-2-deoxycytidine (5 –Aza, SIGMA, A3656) or PBS for 4 days ...
-
bioRxiv - Cell Biology 2024Quote: ... Dichlormethane (DCM, ≥99 %), 4,5-Dimethoxy-2-nitrobenzyl chloro formate (NVOC-Cl, 97%) were purchased from Sigma Aldrich. Fmoc-Hyp(tBu)-OH (99 % ...
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μl of 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT, 0.5 mg/ml in PBS, Sigma-Aldrich, USA) with 1 μM of menadione (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... along with 5% 2-hydroxy-1-[4(hydyroxyethoxy)phenyl]-2- methyl-1-propane (Irgacure 2959; Sigma-Aldrich) photoinitation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2024Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′-TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous references (PPIA ...
-
bioRxiv - Biophysics 2024Quote: ... respectively: EcoEF7,3_For: 5’-GCACTATTTGCTATATATTGTGTGGTTGAATCTTTTTTCAACTACATCTAGTATCTC-3’ and EcoEF7,3_Rev: 5’-GAGATACTAGATGTAGTTGAAAAAAGATTCAACCACACAATATATAGCAAATAGTGC-3’ were ordered from Sigma-Aldrich, resuspended and annealed in buffer containing 10 mM Tris pH 7 ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were washed 2-3 times with warmed PBS followed by 50 μM 5-chloro-2’-deoxyuridine (CldU, Sigma #C6891) for 20 minutes or 50 μM CldU with 4mM hydroxyurea (HU ...
-
bioRxiv - Molecular Biology 2021Quote: Anti-α-tubulin (Sigma-Aldrich, clone B-5-1-2), anti-METTL18 (PROTEINTECH GROUP ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μM 5-Fluoro-2’-deoxyuridine (FUdR, Sigma-Aldrich) for 3.5 hours at 37°C ...
-
bioRxiv - Biophysics 2020Quote: ... Mouse anti-α-tubulin (B-5-1-2) (T5168; Sigma), Mouse anti polyglutamylated tubulin ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-alpha-tubulin B-5-1-2 (Sigma, T5168), mouse anti-alpha-tubulin TAT-1 (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-tubulin MAb (clone B-5-1-2; Sigma) was used at a 1/4,000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Tubulin (clone B-5-1-2) from Sigma Aldrich and anti-MUC5AC (clone 45M1 ...
-
bioRxiv - Cell Biology 2024Quote: ... α-tubulin (T6074, clone B-5-1-2; Sigma-Aldrich), GFP (ab290 ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 mM EDTA and 1 % [v/v] protein phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich)) were added at a concentration of 2 mL/g tissue powder ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The cell lysates were transferred to a 96-well plate and reactions were initiated by adding 1 mM 5-thiobutyl butyrolactone (TBBL) and 1 mM 5′,5-dithiobis (2-nitrobenzoic acid) (DTNB) (Sigma Aldrich, D8130) in Pon2 activity assay buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3% 2-Hydroxyethyl Agarose (Sigma) was prepared and stored in a water bath at 45 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... 3% 2-mercaptoethanol (Sigma Aldrich), and 0.25 mg/ml Proteinase K (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 and 3 (Sigma-Aldrich). The homogenate was sheared through a 26-gauge needle and sonicated three times for 20-second bursts ...
-
bioRxiv - Cell Biology 2020Quote: ... sodium acrylate (SA, 97-99%, 408220, SIGMA), ammonium persulfate (APS ...
-
bioRxiv - Cell Biology 2021Quote: ... sodium acrylate (SA, 97–99%, 408220, SIGMA), ammonium persulfate (APS ...
-
bioRxiv - Cell Biology 2022Quote: ... sodium acrylate (SA, 97–99%, 408220, SIGMA), ammonium persulfate (APS ...
-
bioRxiv - Biophysics 2020Quote: ... Sodium acrylate (SA, 97-99%, 408220, Sigma), Sodium chloride (NaCl ...
-
bioRxiv - Cell Biology 2022Quote: ... Sodium Acrylate 97-99% (SA)(SIGMA, 408220), Paraformaldehyde (Electron Microscopy Science ...
-
bioRxiv - Genomics 2020Quote: ... 97% sodium acrylate powder (Sigma-Aldrich, 408220), ammonium persulfate (APS ...
-
bioRxiv - Microbiology 2021Quote: ... and γ-Terpinene (97 %, Sigma Aldrich 223190) were diluted in 5% DMSO to obtain a stock solution of 10 mg/mL for each compound.
-
bioRxiv - Cell Biology 2020Quote: ... Golgin-97-rabbit polyclonal antibody (Sigma-Aldrich) was used for western blotting at 1:2000 and for immunofluorescence at 1:200 ...
-
bioRxiv - Cell Biology 2020Quote: ... human Golgin-97 (synthetized by Sigma-Aldrich; #1 ...
-
bioRxiv - Biophysics 2022Quote: Sodium acrylate (SA, 97%, 408220, Sigma-Aldrich), Acrylamide (AA ...
-
bioRxiv - Bioengineering 2022Quote: ... and 10 mM EDOT (Sigma Aldrich 97%) in DI water and stirring it for 2 hours at room temperature ...