Labshake search
Citations for Millipore Sigma :
251 - 300 of 4532 citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... non-targeted shRNA (SHC016, Sigma-Aldrich), or empty vector plko.1 lentivirus ...
-
bioRxiv - Cancer Biology 2021Quote: Mission shRNA vectors purchased from Sigma were transiently transfected along with pCMV-VSVG and ps-PAX2 into HEK 293T cells using polyethylenimine (PEI ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNAs targeting ERF (Sigma-Aldrich: TRCN000001391) and lentiviral GFP-tagged ERF (GeneCopoeia ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1 HIF2α shRNA (#TRCN0000082307, Sigma).
-
bioRxiv - Biochemistry 2020Quote: ... The shRNAs used were from Sigma shRNA clone library which were identified by TRC numbers.
-
bioRxiv - Cancer Biology 2021Quote: ... Vectors encoding for random shRNA (Sigma) were used as a control ...
-
bioRxiv - Neuroscience 2021Quote: ... TurboGFP-targeting shRNA (SHC004 Sigma-Aldrich) and a universal non-targeting shRNA (LV015-G ABM ...
-
bioRxiv - Cancer Biology 2020Quote: ... A non-target shRNA (shNT) (Sigma MISSION shRNA non-mammalian control SHC002 ...
-
bioRxiv - Cell Biology 2022Quote: ... LentiCRISPRv2 vector with predesigned shRNA (Sigma mission shRNA TRCN0000312779 ...
-
bioRxiv - Neuroscience 2022Quote: ... Control non-targeting shRNA (Sigma, SHC002), and shRNAs targeting Mmp24 and Pcdhαc2 were obtained from Sigma (Mmp24 shRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control-shRNA (Sigma Cat# SHC016) was generated by co-transfecting the lentiviral plasmids in HEK293T cells with VSV-G (the envelop expressing plasmid ...
-
bioRxiv - Biochemistry 2023Quote: ... or scramble shRNA (SHC002, Sigma-Aldrich) using Lipofectamine 3000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... shGLUT1 (Mission TRC shRNA, TRCN0000043583, Sigma), shIGFR1#1 (Mission shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... shIGFR1#1 (Mission shRNA, TRCN0000039677, Sigma), shIGFR1#2 (Mission TRC shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... ShRNA constructs were obtained from Sigma: shControl (SHC002) ...
-
bioRxiv - Molecular Biology 2024Quote: Commercially available shRNA lentiviral vectors (Sigma, TRCN0000147948 ...
-
bioRxiv - Neuroscience 2020Quote: ... Mission ShRNA bacterial Glycerol stock NM_026582) and scramble control (Mission TRC2 PlkO.5-PURO Non-Mammalian shRNA control Plasmid) were purchased from Sigma-Aldrich. Wnt3a plasmid pLCN-Wnt3a-HA (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: ... HEK293T were plated at 50% confluency on 60 mm dishes and transiently transfected with the gene specific shRNA pLKO.1 plasmid (Sigma), packaging plasmid (Δ8.9 ...
-
Cell culture dimensionality influences mesenchymal stem cell fate through cadherin-2 and cadherin-11bioRxiv - Cell Biology 2019Quote: pLKO.1 plasmids containing short hairpin RNA (shRNA) sequences targeting cadherin-11 or cadherin-2 were obtained from Sigma-Aldrich together with a scrambled negative control ...
-
bioRxiv - Cancer Biology 2020Quote: ... lentiviral vectors expressing the shRNA targeting PAT4 were produced as follows: HEK293T cells were co-transfected with shRNA-PAT4 plasmid DNA (5’-CCGGCCTTGATAAATGAGCAGAATTCTCGAGAATTCTGCTCATTTATCAAGGTTT TTG-3’; TRCN0000043984; Sigma) or new shRNA lentivirus (GTTGTCCTTATTGGAGATTC ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral-mediated shRNA knockdown was carried out as described previously (Cui et al., 2012) with plasmids encoding shRNA against RanBP2 (shRNA1: TRCN0000003452, shRNA3: TRCN0000003454, Sigma), AGO1 (shRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Viral vectors for shRNA expression as well as empty-cassette plasmids used as vector controls were obtained from the Mission TRC library (Sigma) via the McGill Platform for Cellular Perturbation (clone information and sequences in Supplementary Table 2) ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were transfected with 0.5 µg/well of pLKO.1-puro Vector empty or with plasmids containing the target shRNA sequence for the indicated kinases (Mission Library, Sigma). 48h after transfection ...
-
bioRxiv - Cell Biology 2020Quote: Silencing of MASTL and TSC2 was performed using pLKO.1 lentiviral plasmids encoding specific siRNA (ON-TARGET SMARTpool, Dharmacon) or shRNA sequences (Sigma), as previously described 59 ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 Fbxo45 shRNA plasmids shFbxo45b (TRCN0000201180, target sequence GACATGGAGGATAAGACTTTA) and shFbxo45a (TRCN0000339817 target sequence TGGAATCTGGTGGACAATAAT) were obtained from Sigma. When co-transfected with Flag-Fbxo45 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T were plated at 50% confluency on 60 mm dishes and transiently transfected with the gene specific shRNA pLKO.1 plasmid (Sigma), packaging plasmid (Δ 8.9 ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293T were plated at 40% confluency on 60 mm dishes and transfected with the gene specific shRNA pLKO.1 plasmid (Sigma), packaging plasmid (Δ8.9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293T were plated at 50% confluency on 60 mm dishes and transiently transfected with the gene specific shRNA pLKO.1 plasmid (Sigma), packaging plasmid (Δ8.9 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human IPMK cDNA was subcloned into pGEX4T plasmid (Sigma Aldrich), expressed in Escherichia coli ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell lines stably expressing shRNA to human FBXO7 were generated as described previously (33-35) and selected with 2 µg/mL puromycin (Sigma-Aldrich). To vary glucose concentration ...
-
bioRxiv - Neuroscience 2021Quote: ... Cell lines stably expressing shRNA to human FBXO7 were generated as described previously (20) and selected with 2 μg/mL puromycin (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2020Quote: Phf6 shRNA sequences were designed using http://cancan.cshl.edu/RNAi_central/RNAi.cgi?type=shRNA and purchased from Sigma-Aldrich [39] ...
-
bioRxiv - Neuroscience 2020Quote: We purchased a MISSION shRNA vector library encoding the microRNA-adapted shRNA targeting mouse Nwd1 (Sigma-Aldrich). Among five shRNA clones (TRCN0000257630 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 10 µg lentiviral expression constructs shRNA pLKO.1-puro (G9a Mission shRNA, Sigma-Aldrich, TRCN0000115671, NM_025256,); For DDX5 knockdown the custom sequence AACCGCAACCAUUGACGCCAU (Sigma-Aldrich DDX5 Mission shRNA plasmid DNA ...
-
bioRxiv - Immunology 2020Quote: ... Lentiviral constructs encoding a non-targeting shRNA or CYLD-targeting shRNA (SHCLNG-NM_173369) were obtained from Sigma.
-
bioRxiv - Cancer Biology 2021Quote: The lentiviral shRNA clones targeting mouse aldolase A and nontargeting shRNA control were obtained from Sigma Aldrich in the pLKO vector ...
-
bioRxiv - Cell Biology 2020Quote: ... The shRNAs in pLKO.1-puro (MET MISSION Lentiviral Transduction shRNA particle) were commercially purchased from Sigma (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentiviral shRNA constructs were derived from the pLKO.1-based TRC1 shRNA library (Sigma-Aldrich/RNAi Consortium); the following vectors were used ...
-
bioRxiv - Physiology 2024Quote: Lentivirus expressing non-target shRNA (SHC002) and shRNAs targeting Msi2 were generated according to manufacturer’s instruction (Sigma). HEK293FT cells were co transfected with vectors expressing shRNA and lentivirus packaging plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... GBM#U3013 cells were infected with lentiviral particles generated by transfecting HEK293 cells with pLKO.1-puro plasmids from the Mission shRNA library (Sigma-Aldrich). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: For depletion of ATG14 and NOX2 virus particles were generated in HEK 293-T cells transfected with the control vector pLKO.1 (pLKO.1 non-target) or the respective shRNA plasmid (shATG14 (KD1: TRCN0000142849 or KD2: TRCN0000144080) or shNOX2 (KD1: TRCN0000064590 or KD2: TRCN0000064591) (Sigma Aldrich), the gag/pol plasmid psPAX2 (Addgene ...
-
bioRxiv - Physiology 2022Quote: Lentiviral pLKO.1 plasmids harboring shRNAs directed against SLC7A1 (ID: TRCN0000042967) and DHPS (ID: TRCN0000330717 and ID: TRCN0000330796) were obtained from Sigma-Aldrich. Cells were transduced with the shRNA plasmids where the 714bp sequence encoding for EGFP was inserted in place of the puromycin gene at the unique BamHI and KpnI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmids encoding shRNA against SYNJ2BP and AMPK α1 and α2 (TRCN0000139049, TRCN0000024000 and TRCN0000024046, respectively) as well as a control shRNA plasmid (TR30021) were purchased in pLKO from Sigma-Aldrich. PINK1-kinase dead-MS2-PP7 ...
-
bioRxiv - Molecular Biology 2020Quote: For shRNA transduction, individual shRNAs targeting mouse Arid1a (TRCN0000238303, shArid1a-#1; TRCN0000238306, shArid1a-#5) were obtained from Sigma Mission shRNA library (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... pLKO lentiviral vectors expressing non-targeting shRNA and shRNAs targeting SOX2 and SOX15 were purchased from Sigma-Aldrich.
-
bioRxiv - Cancer Biology 2021Quote: Two pLKO.1-shRNA constructions against the HDAC6 transcript were selected from the MISSION shRNA collection (SIGMA Aldrich). The constructs references were TRCN0000314976 for sh1_HDAC6 and TRCN0000004839 for sh2_HDAC6 ...
-
bioRxiv - Pathology 2020Quote: ... the MISSION® TRC shRNA transfer vector containing the ClC-5 shRNA target sequence CACCGAGAGATTACCAATAA (Sigma-Aldrich, #TRCN0000043904) was co-transfected with the third generation vectors VSVG ...
-
bioRxiv - Cancer Biology 2020Quote: ... Non-targeting shRNA control (shCtrl) and shRNA constructs targeting Keap1 (TRCN0000156676) and CUL3 (TRCN0000012778) were purchased from Sigma and packaged into lentiviral vectors using standard protocols.
-
bioRxiv - Microbiology 2023Quote: ... pLKO.1-based Mission shRNA constructs targeting Raf1 were obtained from the Sigma-Aldrich Mission shRNA library (Sigma/Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: Lentiviral constructs containing the shRNA targeting the gene of interest were obtained from the MISSIONx shRNA library (Sigma), facilitated by Erasmus Center for Biomics (Key Resource Table) ...