Labshake search
Citations for Millipore Sigma :
51 - 100 of 4285 citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... shRNA plasmids were used from the Mission library (Sigma), for RUNX1 (TRCN0000338427 ...
-
bioRxiv - Biochemistry 2020Quote: The shRNA-containing pLKO.1 lentiviral plasmids (Sigma-Aldrich) were co-expressed with pMD.2G and psPAX2 in 293T cells for 48 hours with Lipofectamine 3000 (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: Lentiviral plasmids encoding shRNA were obtained from Sigma-Aldrich. Each plasmid was transformed into One Shot Stbl3 chemically competent cells (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... pLKO.1-puro eGFP shRNA control (Plasmid SHC005; Sigma) produced by packaging line HEK293FT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Non-targeting shRNA plasmid pKLO.1-puro (Sigma, SHC202) and empty pKLO.1-hygro (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... pLKO.1-puro plasmids encoding scrambled shRNA and five FYCO1-targeted shRNAs were purchased from Sigma Aldrich. For details on oligonucleotides refer to (Table S1).
-
bioRxiv - Physiology 2023Quote: Glycerol stocks of pLKO.1-puro lentiviral plasmid vectors containing shRNA targeting human Nup93 (NM_014669) and an empty vector insert (shEmpty) were purchased from Sigma-Aldrich. Lentivirus expressing shNup93 or shEmpty were generated by PEI-mediated co-transfection of pLKO.1-puro ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragments encoding shRNAs directed against human CDH13 mRNA (Sigma) were cloned into the pTRIPΔU3-EF1α-EGFP lentiviral vector ...
-
bioRxiv - Microbiology 2022Quote: The shRNAs targeting human MARCHF8 were purchased from Sigma-Aldrich. The sgRNAs targeting mouse Marchf8 were designed by the web-based software ChopChop (http://chopchop.cbu.uib.no ...
-
bioRxiv - Molecular Biology 2023Quote: Production of short hairpin RNA (shRNA)-expressing lentiviral particles was performed as described previously53 using plasmids expressing shRNAs targeting ZFC3H1 (Sigma-Aldrich MISSION shRNA, TRCN0000130498) or a non-targeting control (Addgene ...
-
bioRxiv - Immunology 2021Quote: Lentiviral shRNA (pLKO.1) plasmids for mouse Suv39h1 (7µg) (Sigma TRCN0000097439 ...
-
bioRxiv - Immunology 2021Quote: Various lentiviral shRNA plasmids against RNH1 were purchased from Sigma and lentvirus was generated as previously described (Chennupati et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... the Mission shRNA plasmid (TRCN0000289279) was purchased from Sigma-Aldrich.
-
bioRxiv - Cancer Biology 2021Quote: ... Control shRNAs in the same plasmid were also purchased (Sigma). The IDs for the ERK5 shRNAs used are ...
-
bioRxiv - Cell Biology 2024Quote: ... pLKO.1-Neo-CMV-tGFP TIAM1 shRNA plasmid (Sigma Aldrich, Cat # 07202334MN ...
-
bioRxiv - Pathology 2024Quote: ... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the MISSION shRNA lentiviral plasmids pLKO.1-puro with shRNA target sequence CCAGATGACTTGATCGGATAT (TRCN0000190340, Millipore Sigma) and pLKO.005-puro with shRNA target sequence GTTGGCCTGAACCTGCTTTAT (TRCN0000382281 ...
-
bioRxiv - Neuroscience 2023Quote: ... received a non-target shRNA viral injection (NT-shRNA; SHC016: MISSION® pLKO.1-puro non-Target shRNA Control Plasmid DNA; Sigma Aldrich, St. Louis, MA, USA) to determine any effects of surgery alone on respiratory behaviour ...
-
bioRxiv - Biochemistry 2021Quote: ... 105 MA104 cells were co-transfected with the plasmid pCMV-HyPBase encoding the hyperactive variant of PiggyBac transposase56,57,22 along with the plasmid pPB[shRNA]-EGFP:T2A:Puro-U6 harbouring shRNA targeting RVA NSP2 gene using Lipofectamine 3000 (Sigma-Aldrich), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... SK.N.BE2 cells were infected with TRIM67 Mission lentiviral shRNA plasmids (Sigma). For virus production ...
-
bioRxiv - Neuroscience 2020Quote: ... We also used MISSION shRNA plasmids for mouse Paics (Sigma-Aldrich). Among five clones (TRCN0000076100 ...
-
bioRxiv - Microbiology 2023Quote: ... pPAX2 and pLKO.1-puro shRNAs expressing plasmids (MISSION, Sigma-Aldrich). Produced lentiviruses were concentrated and quantified as previously ...
-
bioRxiv - Physiology 2024Quote: ... Plasmids containing these shRNAs were obtained from Sigma (St. Louis, MO). We determined that the targeting sequence CCGTCCCTACATGGATGAAAT was most efficient in knocking down mTOR in primary human trophoblast cells ...
-
bioRxiv - Cancer Biology 2019Quote: Control pLKO.1-LacZ shRNA and four different lentiviral shRNA pLKO.1 plasmids designed to silence DARPP-32 protein expression were purchased from Sigma. To prepare the lentivirus ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (CAACAAGATGAAGAGCACCAA) or ATF4-targeted shRNA (GCCTAGGTCTCTTAGATGATT) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Cell Biology 2023Quote: The MISSION® pLKO.1-puro Non-Target shRNA (scr) and the shRNA against the UTR of human ZIP11 gene (5’-TCCTGATTGACTCTGATTATA-3’, Cat. TRCN0000434903) were from Sigma-Aldrich. The mammalian gene expression vector pLV[Exp]-EGFP/Neo-Ef1A (pLV ...
-
bioRxiv - Microbiology 2021Quote: ... 5 validated LAMP1 shRNAs were ordered from human Mission lentiviral library (Sigma). HEK293T/17 and A549 cells grown to ∼70% confluency in 6-well plates were transduced with 0.5 ng p24/well of shRNA pseudoviruses ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.6 µg of DNA per well with the GFP-LC3B expression plasmids with or without scrambled shRNA or a mixture of five FYCO1-targeting shRNAs (Sigma Aldrich). The efficiency of shRNAs targeting Fyco1 in mouse cells were verified in N2A neuroblastoma cells (Figure S4D) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Non-targeting control pLKO shRNA lentivirus plasmid (MISSION, SHC002) was kindly provided by Tianyan Gao and pLKO shRNAs targeting PTP4A3 were purchased from Sigma-Aldrich; target sequences are listed in Supplemental Table 2.
-
bioRxiv - Neuroscience 2020Quote: ... a modified pLKO.5 vector containing shRNA expression cassettes targeting syt1 (TRCN0000093258) and syt9 (TRCN0000379591) from Mission shRNA plasmids (Sigma-Aldrich) was used.
-
bioRxiv - Cancer Biology 2023Quote: ... Stable KD of EIF4G2 was generated by infecting HEC-1A or RL95-2 cells with lentiviruses harboring pLKO.1-puro plasmid expressing shRNA targeting GFP (Control) or shRNA targeting EIF4G2 (Sigma TRCN0000147914), followed by selection using puromycin ...
-
bioRxiv - Cell Biology 2024Quote: ... individual ACVRL1-targeting short hairpin-RNA (shRNA) clones (Table 1) were inserted into the MISSION® 3X-LacO Inducible shRNA plasmid backbone (Sigma). Both clones target a similar region in the ACVRL1 transcript and produced similar levels of knockdown ...
-
bioRxiv - Cancer Biology 2020Quote: ... cloned into the pLKO.1 puro-vector (MISSION® shRNA plasmids, Sigma), were used ...
-
bioRxiv - Cancer Biology 2022Quote: As lentiviral shuttle backbone we used a pLKO shRNA plasmid (Mission SIGMA). As control we used pLKO shRNA empty expression vectors ...
-
bioRxiv - Immunology 2022Quote: ... pLKO.1 plasmids either containing the shRNA sequence: CCGGGCAGAAGATATTCACAGACATCTCGAGATGTCTGTGAATATCTT-CTGCTTTTTTG (TRCN0000148136, SIGMA) or the scrambled shRNA sequence ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmid encoding the shRNA against CDT1 was from Sigma-Aldrich (TRCN0000174484). The CDT1-pCDNA3 plasmid is described in Coulombe et al.42.
-
bioRxiv - Immunology 2020Quote: Plasmid included Mission® pLKO-puro Non-Target shRNA (Sigma-Aldrich, #SHC016V), pLKO shRNA targeting BBS1 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... and the non-target control shRNA plasmid were purchased from Sigma-Aldrich. Lentivirus-containing supernatants were collected ...
-
bioRxiv - Neuroscience 2023Quote: ... shRNA plasmids were cloned by the insertion of the siRNA sequences (Sigma) shown to be effective against Ncan mRNA (Okuda et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... shRNA plasmids were cloned by the insertion of the siRNA sequences (Sigma) shown to be effective against Ncan mRNA (Okuda et al. ...
-
bioRxiv - Cancer Biology 2021Quote: MISSION shRNA targeting mouse or human PSME4 or RFP were obtained from Sigma (TRCN0000176569 ...
-
bioRxiv - Genetics 2022Quote: Viral particles were made from shRNA lentiviral vector targeting human EGR1 (Sigma-Aldrich MISSION shRNA Target Clone ID TRCN000027385 ...
-
bioRxiv - Microbiology 2023Quote: ... The shRNAs targeting human MARCHF8 were ordered from Sigma-Aldrich (St. Louis, MO). The sgRNAs targeting Marchf8 were designed using the web-based software ChopChop (chopchop.cbu.uib.no ...
-
bioRxiv - Cell Biology 2020Quote: ... VAMP7 shRNA (Sigma-Aldrich, Mission shRNA, TRCN0000059892), Rab6 shRNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... GMAP210 shRNA (Sigma-Aldrich, Mission shRNA, TRCN0000022021), VAMP7 shRNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Rab6 shRNA (Sigma-Aldrich, Mission shRNA, TRCN0000379588), and Synt16 shRNA (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... or SERPINB3 shRNA (Sigma Mission shRNA, TRCN0000052400). Genetically modified cells were generated through a lentivirus system by transfection of human 293T packaging cells ...
-
bioRxiv - Immunology 2019Quote: ... Mul1 shRNA lentiviruses (shMul1) were prepared using commercial plasmids (TRCN0000040742 and TRCN0000328514, Sigma); TRCN0000040742 ...
-
bioRxiv - Cell Biology 2021Quote: MLK3-shRNAs in lentiviral vector pLKO.1-Puro plasmids were obtained from Sigma. Other plasmids used for lentivirus production were purchased from Addgene ...
-
bioRxiv - Neuroscience 2020Quote: Pre-validated shRNA plasmids were identified on the Broad Institute RNAi Consortium shRNA Library Database and purchased from Sigma-Aldrich (St. Louis, MO). Multiple shRNA plasmids were tested by immunostain analysis of Nav1.1 density (see Supplemental Figure 5 for validation data) ...