Labshake search
Citations for Millipore Sigma :
151 - 200 of 4532 citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: The MISSION pLKO.1-puro human TDP-43 (TRCN0000016038) and control shRNAs (Sigma Aldrich SHC007 and SHC016) were used to produce lentivirus ...
-
bioRxiv - Immunology 2021Quote: Lentivirus based knockdown of human ATG16L1 (5’-ACTGTAGCTTTGCCGTGAATG-3’) was performed using MISSION shRNA constructs (Sigma-Aldrich) and psPAX2 packaging system ...
-
bioRxiv - Immunology 2020Quote: ... MISSION shRNA Lentiviral Transduction Particles against human CLPP (TRCN0000291174) or eGFP (RHS4459) were purchased from Sigma-Aldrich and Horizon Discovery respectively ...
-
bioRxiv - Biophysics 2021Quote: ... IRSp53 60950 shRNA and control Non-Targeting shRNA were purchased from Sigma Mission for viral transfection and stable cell line creation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Two different short hairpin (shRNA, from Sigma-Aldrich shRNA library; Table 1), scrambled shRNA control (Addgene plasmid #1864) ...
-
bioRxiv - Neuroscience 2024Quote: ... or one of the RCOR3-shRNA-mCherry-BSD plasmids or the TetO-SOX9-NFIB-mPlum-Puro plasmid using Polyethyleneimine (Sigma-Aldrich, USA, #408727). DNA is added in a ratio of 4:2:1:1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The shRNAs constructs (Sigma) used in this study are as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... The shRNAs constructs (Sigma) used in this study are as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA construct shMYC:TRCN0000039642 (Sigma) was cloned into pLKO.1-Tet-Neo obtained from Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1 (shRNA: TRCN0000007859, Sigma), AGO2 (shRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... GW182 (shRNA: TRCN0000376423, Sigma), or control vector (pLK0.1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Dicer (shRNA: TRCN0000051258, Sigma), GW182 (shRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO2 (shRNA: TRCN0000011203, Sigma), Dicer (shRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... MISSION shRNA clones (Sigma) in pLKO.1 backbone were ...
-
bioRxiv - Genomics 2020Quote: ... shRNAs obtained from Sigma (ISL1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... SHP2 (MISSION shRNA; Millipore-Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... The shRNAs constructs (Sigma) used in this study are as follows:
-
bioRxiv - Genomics 2024Quote: ... Mission shRNAs (Sigma-Aldrich) were used for RNA interference ...
-
bioRxiv - Molecular Biology 2023Quote: ... The shRNAs constructs (Sigma) used in this study are as follows ...
-
bioRxiv - Biophysics 2024Quote: ... scramble shRNA (Sigma #SHC002) had the following sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Vdac2 shRNA (Sigma). To prepare lentiviral particles ...
-
bioRxiv - Microbiology 2023Quote: ... MISSION shRNA clones (Sigma) used for knockdown are as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... c-Jun shRNA (Sigma, mission shRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... MISSION shRNA clones (Sigma) used for knockdown are as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... tardbp shRNA (Sigma, TRCN0000016038), or MARK3 shRNA (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... shRNA control (Sigma, SHC002), tardbp shRNA (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... lentiviral shRNA expression plasmids from the RNAi Consortium (TRC) Mission library were obtained from Sigma-Aldrich (TRCN0000083733)61 ...
-
bioRxiv - Neuroscience 2021Quote: ... we treated cells with three different lentiviral particles: shRNA control plasmid DNA (Sigma-Aldrich, Cat# SHC016-1EA), shP2RY14(09 ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were co-transfected with plasmids with AKT-PH::GFP and shRNA against KIAA1109 (Sigma-Aldrich, TRCN0000263343 with 73% knockdown efficiency) ...
-
bioRxiv - Cancer Biology 2022Quote: MISSION® pLKO.1-puro Non-Mammalian shRNA (SHC002) and WDR5 knockdown plasmids were purchased from Sigma. Several clones were tested ...
-
bioRxiv - Cell Biology 2022Quote: ... C2C12 myoblasts were transfected with plasmids encoding small hairpin (sh)-RNA targeting Adamtsl2 (Mission shRNA, Sigma Aldrich) using PEI ...
-
bioRxiv - Cancer Biology 2023Quote: ... and shCtrl-2 (MISSION® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA, SHC002, Sigma-Aldrich).
-
bioRxiv - Microbiology 2020Quote: The mouse Rab GTPases shRNA library (317 shRNAs) was extracted from The Mission mouse shRNA library generated by The RNAi consortium (Sigma Aldrich) and prepared as described before (Shi et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... TRCN0000037282 (shRNA Trim39#2) and TRCN0000438509 (shRNA Trim39#3) were from Sigma-Aldrich. Lentiviral particles were produced as previously described (Iréna Lassot et al. ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ST6GAL1 gene shRNA clone was obtained from MISSION shRNA library (Sigma Merck, USA). Plasmid containing shRNA or scrambled control was packaged into lenti virus using packaging vectors pMD2.G and psPAX2 (packaging vectors were a kind gift from Dr ...
-
bioRxiv - Cell Biology 2023Quote: Primary MEFs were infected with shRNA using the mouse Endog-directed shRNA (Sigma), Vdac1 ...
-
bioRxiv - Cancer Biology 2023Quote: Following pLKO.1 shRNA were used: shINSR#1 (Mission TRC shRNA, TRCN0000010523, Sigma), shINSR#2 (Mission TRC shRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... shRNAs stably integrated in mouse and human cells were selected with 10 and 2 μg/ml puromycin (Sigma), respectively ...
-
bioRxiv - Cancer Biology 2021Quote: Forward and reverse oligonucleotides for a MYL9 and MYL12b-targeting shRNA and a nontargeting shRNA construct were designed using The RNAi Consortium collection (MISSION® shRNA, Sigma Aldrich).
-
bioRxiv - Cancer Biology 2019Quote: In utero electroporation was performed as described previously [1] using the following plasmids: pLKO.1-Cic shRNA (Sigma, TRCN0000304642 ...
-
bioRxiv - Neuroscience 2021Quote: ... Hek293T cells were transfected with packaging and envelope expressing plasmids together with PLKO.1-shRNA control (SHC016, SIGMA) or targeting MPC1 (ShMPC1_1 ...
-
bioRxiv - Pathology 2022Quote: ... The cells were transfected with different types of CYP24A1-specific small-hairpin RNA (shRNA)-expressing lentivirus plasmids (Sigma) using FuGENE6 (Roche ...
-
bioRxiv - Genomics 2023Quote: ... The MEF2B shRNA sequences inserted in a pLKO-1 puro plasmid are listed in Table S4 (Sigma, #SHCLNG).
-
bioRxiv - Neuroscience 2024Quote: Plasmid containing the TRIM21 shRNA target sequence GAGTTGGCTGAGAAGTTGGAA with a pLKO.1-hPGK-Puro-CMV-tGFP vector (Sigma, TRCN0000010839 ...
-
bioRxiv - Biochemistry 2021Quote: ... the shRNA oligos targeting LacZ and mouse Tpi obtained from MISSION shRNA Library (Sigma) were first cloned into their respective entry vectors (pENTR-U6) ...
-
bioRxiv - Cell Biology 2022Quote: All shRNA clones were part of the MISSION shRNA product line from Sigma Aldrich. The TRC1.5 pLKO.1-puro non-Mammalian shRNA Control Plasmid DNA (SHC002 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the following short hairpin RNA (shRNA) constructs from the Mission TRC shRNA library (Sigma) were used ...
-
bioRxiv - Cell Biology 2023Quote: ... using commercially available lentiviral vectors encoding the desired shRNAs (MISSION® shRNA, Sigma-Aldrich; shSUN1 - TRCN0000133901 - Target Sequence ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences for shRNAs were identified through the MISSION® Predesigned shRNA libraries (Sigma-Aldrich) and shRNAs were obtained from the La Jolla Institute for Immunology RNAi Center (La Jolla ...
-
bioRxiv - Systems Biology 2024Quote: Lentiviruses containing shRNA hairpins were purchased from the MISSION® shRNA Lentiviral library (Sigma) (Supplementary Table 4.1) ...